Table. 2.

Oligonucleotides sequence used for bIFNT-ORF assay

Accession Gene BankPrimer(5’-3’) Forword and ReverseLength (bp)

bIFNT1 (M60903)F: cagaaaagactttggtcttcc364
bIFNTc1 (AF238613)R: agagagggctctcatcatctc

Locations of oligonucleotides are identical to those in bIFNT1 and bIFNTc1-ORF domain.

Journal of Embryo Transfer 2016;31:335~347 https://doi.org/10.12750/JET.2016.31.4.335
© J Anim Reprod Biotechnol