Table. 1.

Candidate reference genes and qPCR primers used in this study

Gene symbol Full name PCR efficiency (%) Coefficient of determination (R2)  Sequence (5-3)
ACTB Cytoskeletal β-actin 95.1 0.991 F: GGTATTGTTCTGGACTCTGG
R: GGTGGTGGTGAATGAGTAAC
EF-1A Elongation factor 1-alpha 95.7 0.993 F: GCTCTCTGGAAGTTTGAGAC
R: CTCCTTCGAGATACCAGCTT
GAPDH Glyceraldehyde-3-phosphate dehydrogenase 94.8 0.991 F: ACCGCTACACAGAAGACAGT
R: TACATCAGGTACTGGGACAC
PPIB Peptidyl-prolyl cis-trans isomerase B 97.7 0.997 F: CGAGAAAGCAGGACGAATTG
R: AAGTCCCCTCCTTGGATCAT
B-TU Tubulin beta 102.9 0.995 F: ACATTCACTAGGTGGGGGTA
R: GTACTGACAATGTGGCGTTG
UBE2 Ubiquitin-conjugating enzyme E2 99.5 0.997 F: CCAAGCTCTTCTTAGTGCAC
R: CTCCCCACTTCCATCACTTT
RPL3 Ribosomal protein L3 99.1 0.991 F: TCATTGCACACACCCAGACT
R: CAATGACCTCATCCTGTTCG
RPL4 Ribosomal protein L4 99.7 0.992 F: GCTGCTTCAAGACCGCTTAT
R: TGGCCAGCTTTCTCTGAAAC
RPL5 Ribosomal protein L5 96.8 0.996 F: AGATGAGGATGGCAAACCAG
R: TCGCTGCTCTCAGAGTCAAA
RPL7 Ribosomal protein L7 97.8 0.994 F: CAAGCTGAACACTCCAAACG
R: TCCACAGCACTGATGTTTCC
RPL7A Ribosomal protein L7A 95.5 0.995 F: GCTGTCGAAAAAGGTTGAGC
R: TGCTTCAAGACAGCGAACTG
RPL8 Ribosomal protein L8 98.5 0.995 F: TGGAAACTACGCCACAGTCA
R: GTCCTGCCTTCAACATTGGT
RPL36 Ribosomal protein L36 104.1 0.999 F: TGCGCTGAAACTACTTCCTC
R: GACTGTTGTGCTTTCCTCTG
RPS18 Ribosomal protein S18 96.4 0.999 F: GGTTATACCCGAGAAGTTCC
R: GTCTTTGTGTGCTGACCTCT
Journal of Animal Reproduction and Biotechnology 2019;34:280~291 https://doi.org/10.12750/JARB.34.4.280
© J Anim Reprod Biotechnol