Table. 1.

Oligonucleotide primers for RT-PCR analysis

 Gene name  Accession gene bank  Primer of forword and reverse Length (bp)
IFNT M60903 F: cagaaaagactttggtcttcc 166
R: agtgcagagctgctccagga
CDX2 XM_871005 F: tatcaccatccggaggaaag 414
R: gagggctaggtcagctggta
EOMES XM_001251923 F: actggttcccactggatgag 226
R: cacagcaatgaactgcgttt
ACTB BC102948 F: ctcttccagccttccttcct 178
R: gggcagtgatctctttctgc
Journal of Animal Reproduction and Biotechnology 2019;34:292~299 https://doi.org/10.12750/JARB.34.4.292
© J Anim Reprod Biotechnol