Inflammation of the mammary gland (mastitis) caused by common pathogens among lactating dairy cows leads to considerable economic loss via reduced milk yield, compromised milk quality, and increased veterinary costs (Zhao and Lacasse, 2008). Issues such as expensive treatment and widespread epidemics not only exert an economic impact but also seriously affect the welfare and health of cows (Viguier et al., 2009). The etiological agents of inflammation include different gram-positive and gram-negative bacteria that can be either contagious (e.g., Staphylococcus aureus, Streptococcus agalactiae, Mycoplasma spp.) or acquired from the environment (e.g., Escherichia coli, Enterococcus spp., coagulase-negative Staphylococcus, S. uberis) (Cheng and Han, 2020). As the primary pathogen of contagious mastitis, S. aureus can invade bovine mammary epithelial cells, thus evading immune defenses and resulting in persistent infections (Geng et al., 2020).

MAC-T cells are characterized by an increase in number and size of casein secretory vesicles and alpha S- and beta-casein secretion from primary bovine mammary alveolar cells following stable transfection with SV-40 large T-antigen (Huynh et al., 1991). Our previous study showed that duct-like tissue was successfully formed after six weeks of transplantation of cytokeratin14 and cytokeratin 18 positive MAC-T cells into mouse dorsal tissue (Park et al., 2016). In addition, co-culture of MAC-T cells and murine preadipocyte 3T3-L1 cells were established and evaluated milk protein production (Lee et al., 2017).

Lipopolysaccharide (LPS) is an important inflammatory and infectious factor in bacterial mastitis, which treats MAC-T as a mastitis cell model in vitro (Liu et al., 2022). LPS treatment upregulates the mRNA abundance of tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-1β and decreases the viability of MAC-T cells (Sun et al., 2020). Several studies have used MAC-T cells to describe LPS- induced mastitis and in therapeutic studies for mastitis (Geng et al., 2020; Jing et al., 2021).

Autophagy is a proteolytic mechanism by which cytoplasmic components, including damaged organelles, toxic protein aggregates, intracellular bacteria, and viral pathogens, are sequestered in autophagosomes or lysosomes for bulk degradation and subsequent recycling (Münz, 2009). S. aureus is an important pathogen that causes chronic and subclinical mastitis in cows. Infection with S. aureus increases the protein expression of microtubule-associated protein 1 light chain 3-B (MAP1LC3, also called LC3-B) and sequestosome-1 (SQSTM1, also called p62) in bovine mammary epithelial cells (Wang et al., 2019).

In the present study, we examined autophagy signaling when bovine mammary epithelial cells were challenged with virulence factors while responding to mastitis. We also analyzed several molecular signaling factors to understand their potential role in mastitis.

Cell culture and treatment

The bovine mammary epithelial (MAC-T) cells were cultured in Dulbecco’s modified Eagle medium (GIBCO/BRL, Grand Island, NY, U.S.A.) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (GIBCO) at 37℃ in an atmosphere of 95% air and 5% CO₂. To investigate the effects and possible mechanisms of LPS-induced cell death, cells were treated with different concentrations of LPS (0-50 µg/mL) for 24 to 72 h. The cells were harvested at various time points and subjected to experiments.

Cell viability assay

The cell proliferation assay was performed using the EZ-Cytox Viability Assay Kit (Daeillab Service, Seoul, Korea, #EZ1000) following the manufacturer’s instructions. MAC-T cells were seeded in 96-well plates at a density of 2 × 10³ cells/well for 24 h, and the media was replaced with fresh media containing different concentrations of LPS (0, 1, 10, or 50 µg/mL). The cell viability assays were performed at 24 h, 48 h and, 72 h post-treatment. Briefly, the assay reagent (10 µL/well) was added, incubated for 30 min and absorbance was measured at 450 nm using a spectrophotometer.

Immunocytochemistry

MAC-T cells were rinsed twice with PBS and fixed with 4% paraformaldehyde for 10 min, followed by membrane permeabilization with Triton X-100 (0.05% in PBS) for 10 min. Nonspecific protein binding was blocked with 1% BSA in PBS for 1 h at 25℃. Cells were incubated with LC3A/B (Cell Signaling Technology, Danvers, MA) antibodies at a dilution of 1:100 overnight at 4℃. After washing with PBS, the cells were incubated with Alexa Fluor® 488 Donkey anti-Rabbit IgG for 1 h at room temperature. For nuclear staining, 1 µg/mL DAPI was added for 10 min. The coverslips were mounted using a mounting solution and the immunostained cells were observed under a fluorescence microscope (Nikon, Tokyo, Japan).

Isolation of RNA and quantitative PCR

Total RNA was extracted from MAC-T cells using the RNeasy Mini Kit (Qiagen) with on-column DNase treatment (Qiagen). Complementary DNA was synthesized from 1 µg of total RNA using SuperScript^TM III Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA) with Oligo (dT)30 primers, according to the manufacturer’s instructions. Target gene PCR amplification was carried out for 30 cycles of 30 s at 95℃, 10 s at 57℃, and 20 s at 72℃. The primers were designed using Primer3 (http://frodo.wi.mit.edu). The primers used for the qRT-PCR are listed in Table 1.

Table 1. Primers used for real time reverse transcription-polymerase chain reaction of cDNA from MAC-T cells.

Gene	Forward primer	Reverse primer
ATG3	5′- actggaagtggctgagtacctg -3′	5′- catgttggacagtggtggac -3′
ATG5	5′- gcagttgctcctgaagatgg-3′	5′- tccgggtagctcagatgttc -3′
ATG10	5′- tggatgatttggaggtaaacg -3′	5′- aagcacaggcacttggtagc-3′
ATG12	5′- tgtagagcgaacccgaacc-3′	5′- ggtcccaacttcctggtctg-3′
MAP1LC3B	5′- cgcttacagctcaatgctaatc -3′	5′- catcttcatccttctcgctttc -3′
GABARAPL2	5′- cactcgctggaacacagatg -3′	5′- gtgatgtcggatggaaccag -3′
BECN1	5′- aggagagacccaggaggaag -3′	5′- tgttggcactttctgtggac -3′
GAPDH	5′- gggtcatcatctctgcacct -3′	5′- ggtcataagtccctccacga -3′

Immunoblotting

MAC-T cell lysates were generated using ice-cold radio-immunoprecipitation assay buffer supplemented with protease and phosphatase inhibitors. Total protein was quantified using a BCA protein assay (Thermo Fisher Scientific, Waltham, MA, USA). Samples containing equal concentrations of protein were subjected to 4-20% Mini-TGX (Bio-Rad, Hercules, CA, USA; #456–1096) gel electrophoresis and transferred to polyvinylidene difluoride (PVDF) membranes. Nonspecific binding was prevented by blocking membranes in 1% BSA-TBST (20 mM Tris-HCl at pH 7.5, 150 mM NaCl, and 0.1% Tween-20) for 1 h at 22℃. The membranes were then incubated overnight at 4℃ with a primary antibody diluted in TBST and 1% BSA. The following primary antibodies were used: LC3A/B (1:1,000 dilution; Cell Signaling Technology) and anti-actin (1:5,000 dilution; Santa Cruz Biotechnology). The membranes were washed in TBST and incubated for 1 h with 1:2,000 dilutions of anti-Rabbit and anti-Mouse IgG HRP-linked antibodies (1:1,000 dilution; Santa Cruz Biotechnology) in TBST and 1% BSA. Protein expression was confirmed using enhanced chemiluminescence (Thermo Fisher Scientific, Waltham, MA, USA; 32106).

Statically analysis

Real-time RT-PCR and western blotting assays were performed more than thrice, and the statistical differences between the control and experimental groups were evaluated via Student’s t-test using SPSS statistical package ver. 21.0 for Windows (SPSS, Inc., Chicago, IL, USA). All data are expressed as the mean ± standard error of the mean. The null hypothesis was rejected at p < 0.05.

Effect of LPS on the viability of MAC-T cells

To evaluate the viability of MAC-T cells after LPS treatment, morphological analysis and cell viability assays were performed. The mortality of MAC-T cells significantly increased after 24 h with 50 µg/mL LPS. The 1-10 µg/mL LPS-treated group was not affected until 48 h, but mortality increased at 72 h. MAC-T cells did not grow well with a high dose (50 μg/mL) of LPS treatment (Fig. 1).

Figure 1.Viability rate of MAC-T cells upon lipopolysaccharide (LPS) treatment. (A) Morphology of MAC-T cells after LPS treatment. Scale bars = 50 μm. (B) Viability rate of MAC-T cells after LPS treatment (*p < 0.05).

LPS induces the expression of autophagy-related genes in MAC-T cells

To determine whether the stimulation of bacterial inflammation in MAC-T cells can cause cell damage, we added LPS to the cells for 24 h. Acute cytosolic voids were observed in MAC-T cells treated with 50 μg/mL LPS. In addition, ATG3, ATG5, ATG10, and ATG12 mRNA levels significantly increased in the 50 μg/mL LPS-treated group. Other autophagy-related genes like MAP1LC3b, GABARAPL2, and BECN1 were also highly expressed in the 50 μg/mL LPS-treated group (Fig. 2).

Figure 2.Autophagy-related gene expression of MAC-T cells after LPS treatment. (A) Acute cytosolic voids appear in MAC-T cells after 24 h of LPS treatment. Scale bars = 50 μm. (B) Autophagy related gene expression of MAC-T cells after 24 h of LPS treatment (*p < 0.05).

Expression of autophagy-related proteins in MAC-T cells by LPS

To confirm the expression of autophagy markers, we performed immunocytochemistry and western blotting using an LC3A/B antibody. LC3A/B protein was detected in LPS-treated MAC-T cells. The expression of LC3A/B protein significantly increased in a dose-dependent manner following LPS treatment (Fig. 3).

Figure 3.Autophagy-related protein expression in LPS-induced inflamed MAC-T cells. (A) Representative immunofluorescence image of LC3A/B (green). DAPI (blue) stains the nucleus. Scale bars = 50 μm. (B) Western blotting images and quantification of LC3 protein (*p < 0.05).

Mastitis is a common disease in the dairy industry that causes considerable economic losses worldwide. E coli is an important pathogen that causes bovine mastitis. LPS is a major cell membrane component of E coli that can specifically bind toll-like receptors and induce inflammatory responses, which are predominantly mediated by the activation of the NF-κB signaling pathway. In the present study, we mimicked bacterium-induced bovine mastitis using MAC-T cells and LPS. Interestingly, the viability of MAC-T cells was unchanged in the low-dose condition but was significantly reduced in the 50 μg/mL LPS-treated group. A previous report described that 1 μg/mL LPS treatment increased the levels of TNF-α and IL-1β, IL-6, IL-8, and IL-10 and regulated the activation of normal T cell expressed, and secreted RANTES mRNA in MAC-T cells (Zhang et al., 2018). Another study showed that the viability of MAC-T cells exposed to LPS was concentration-dependent. As the concentration of LPS increases, the viability of MAC-T cells decreases significantly (20, 40, 80, 100, 120, 200, 240, 300, and 400 µg/mL) (Li et al., 2021).

Mammary tissue damage reduces the number and activity of epithelial cells and consequently decreases milk production. Apoptosis or necrosis is induced in mammary tissue (Zhao and Lacasse, 2008). Additionally, LPS is known to induce ER stress, apoptosis, autophagy, and oxidative stress in mammary epithelial cells (Li et al., 2019). Autophagy plays an important role in regulating immunity and in clearing invasive pathogens. Autophagy induction in MAC-T cells was evaluated by confocal microscopy and western blotting. The results showed that S. aureus caused obvious induction of autophagosome formation, transformation of LC3A/B, degradation of p62/SQSTM1 in MAC-T cells, and activation of the PI3K-Akt-mTOR and ERK1/2 signaling pathways (Geng et al., 2020). Another report described that erythropoietin inhibits apoptosis and autophagy of inflammatory MAC-T cells via the PI3K/Akt/mTOR signaling pathway (Liu et al., 2022).

In the present study, treatment with low levels of LPS did not influence mammary epithelial MAC-T cell death, but high doses of LPS induced cell death in mammary epithelial MAC-T cells. In additions, high doses of LPS increased expression of autophagy related genes such as ATG3, ATG5, ATG10, ATG12, MAP1LC3b, GABARAPL2, and BECN1. Autophagy is a tightly regulated process and the key players in this pathway are the ATG proteins and at least 41 ATG genes have been identified. The ATG core proteins are classified in five functional groups: (1) The ULK kinase (Unc-51 like autophagy activating kinase) complex (ULK1 or ULK2, ATG13, RB1CC1/FIP200, and ATG101); (2) the class III phosphatidylinositol 3-kinase (PtdIns3K) complex (BECN1/Beclin 1, ATG14, PIK3C3/VPS34, and PIK3R4/p150/VPS15); (3) the ATG12 conjugation system (ATG7, ATG10, ATG12, ATG16L1, and ATG5); (4) the microtubule-associated protein 1 light chain 3 (LC3) conjugation system (ATG4, ATG7, ATG3, WIPI2, and LC3 protein family); and (5) the ATG9 trafficking system (ATG2A and ATG2B, WIPI4, and the transmembrane protein ATG9A) (Ye et al., 2018). In the present study, autophagy marker LC3A/B protein was highly expressed in a dose-dependent manner following LPS treatment. The detecting LC3 by immunoblotting or immunofluorescence is a reliable method for monitoring autophagy and autophagy-related processes, including autophagic cell death. In conclusion, Low concentrations of bacterial infection induced inflammation in mammary cells, but cell death was not observed. However, a high concentration of bacterial infection induced autophagy-related death of mammary epithelial cells.

None.

Conceptualization, J-K.P., J.M.Y., K.C.; data curation, H-J.P.; writing—review and editing, W-Y.L.

None.

Not applicable.

Not applicable.

Not applicable.

Not applicable.

No potential conflict of interest relevant to this article was reported.