Mesenchymal stem cells (MSCs) isolated from different tissues have the ability to differentiate into various cell types under appropriate biological cue (Pittenger et al., 1999; Jiang et al., 2002). Studies reported that MSCs not only depict a number of germ cell (GCs) traits but its differentiation towards GCs could be propelled by certain chemical cue (Nayernia et al., 2006; Drusenheimer et al., 2007; Huang et al., 2010). Such differentiation potentiality of MSCs could pave the way of exploiting the panacea of infertility.

Sertoli cells provide structural and nutritional support for germ cells, produce many growth factors and cytokines and thereby regulate the process of spermatogenesis through production of necessary factors. Retinoic acid (RA), one among those factors is directly involved in germ cell specific gene expression (Skinner, 2005; Cheng, 2009). Moreover, RA acts as one of the positive cues for the in vitro differentiation of MSCs into germ cells owing to its regulatory role in embryonic prototyping and development (Kouboya et al., 2006; Drusenheimer et al., 2007; Huang et al., 2010). Therefore, the sertoli cell-conditioned medium along with other exogenous factors is being used for the in vitro differentiation of germ cells from MSCs (Monfared et al., 2016). Sertoli cell-conditioned medium has been used along with RA to induce mice bone marrow MSCs and human Wharton’s jelly MSCs towards germ-like cell differentiation in vitro (Maghami et al., 2018; Salem et al., 2019). The effect on germ cell differentiation potential of bovine foetal derived MSCs has been investigated with the use of growth factors like BMP4 and TGFβ1 in combination with RA in culture medium (Cortez et al., 2018).

The purpose of conducting this study was to check whether only RA in DMEM medium could able to differentiate MSCs into germ cell-like cells without using sertoli cell-condition medium and exogenous growth factors in culture medium. Derivation of MSCs from rat bone marrow has been reported earlier but, to the best of our knowledge its differentiation capability towards germ cell-like cells has not yet been recorded. Therefore, we used rat bone marrow derived MSCs as the cellular model and were inducted by RA for 21 days to promote germ cell (GC) differentiation in vitro. Validation of these induced cells was attained by observing the morphological changes of MSCs over the period of time, germ cell specific gene expression study as well as by immunophenotyping of cells with GC specific markers and flow-cytometery based quantification of differentiated cells. The findings depict a more simple way to generate germ cell-like cells from mesenchymal stem cells that might give support to the prospective application of this technology in reproductive health. Moreover, in animal husbandry practice this technique could be useful for the generation and propagation of germplasm of elite animal.

Experimental animals

The adult Sprague Dawley rats were maintained under standard management practice approved by the Institutional Animal Ethics Committee (IAEC) of Indian Veterinary Research Institute, which has the approval of the competent authority of the Government of India.

Isolation, culture and characterization of rat bone marrow derived MSCs

Adult rats were sacrificed under anesthesia, femora and tibias of both the sides were aseptically removed. The bones were thoroughly washed with sterile PBS and flushed out with Dulbecco’s Modified Eagle’s Medium (DMEM) to get the bone marrow cells. The cells were plated at a density of 10⁵ cells/cm² in tissue culture flask (Nunc, Germany) with DMEM-low glucose medium supplemented with 10% FBS, L-glutamine (2 mM), penicillin (100 U/mL), streptomycin (100 µg/mL) and amphotericin B (0.25 µg/mL) (all from Thermofisher), and maintained at 37℃ in a humidified atmosphere of 5% CO₂. Cells upon reaching 70-80% confluence were serially passaged by detaching with 0.25% Trypsin-EDTA (Invitrogen).

The cells were maintained in a low plating density and counted manually at a regular interval. The population doubling time of cells was estimated on logarithmic growth phase based on the growth curve. To assess the capacity of self renewal early passage cells were seeded at low density (50 cells/cm²). After 15 days of culture the plates were fixed and stained with 1% crystal-violet to visualize the colonies.

To define these cell population as multipotent MSCs we characterized them to meet the minimal criteria like morphology, plastic adherent property, colony forming ability, expression of MSC specific surface markers (+/CD 73, CD 90, CD 105 and -/ for CD 45)and ability of multiple-lineage differentiation in vitro. The cells were cultured over cover slip and, were fixed with 4% paraformaldehyde, permeabilized with 0.25% Triton X-100 in PBS followed by blocking of the nonspecific binding sites with 10% normal goat serum. Then after incubation with primary antibodies (1:100; Santa Cruz) followed by FITC conjugated secondary antibodies (1:500; Santa Cruz) cells were counter stained with DAPI ProLong Gold antifade solution (Invitrogen). Images were captured by fluorescence microscope (Carl Zeiss) with Axio Vision 4.0 image analysis system. For the homogenecity evaluation cells were analyzed by flow cytometry (FACS Calibur, BD Bioscience, USA) for the MSC surface markers. For the gene expression study total RNA was extracted by Quick-RNA^TM MicroPrep (Zymo Research) and 1 µg RNA was reverse-transcribed to synthesize complimentary DNA (cDNA) using iScript^TMcDNA Synthesis kit (Bio-Rad, USA). The expression of MSC specific genes CD 73, CD 90, CD 105 and CD 45 was studied by RT-PCR method with rat specific primers (Table 1) with Eva Green supermix (Bio-Rad). PCR products were size-fractionated by gel electrophoresis and the bands were visualized with a UV trans-illuminator (Bio-Rad).

Table 1. List of primers used in the study.

S. No	Genes	Primer sequence	Product (bp)
1	CD 73	F: 5′ ctggtcaacggtggggatggattc 3′ R: 5′ tccgtccttcaactgctgggtaaa 3′	136
2	CD 90	F: 5′ gccagaatcccacaagctccaata 3′ R: 5′ ggagcagcagcagccaggaagtg 3′	111
3	CD 105	F: 5′ cccccgtacgtctcctggctcatc 3′ R: 5′ ggggtgtgtctgggagctcgaa 3′	124
4	CD45	F: 5′ agggcaaggaacaaccgacgatgg 3′ R: 5′ ggagcagccgtgagtgtggtgag 3′	147
5	Stella	F: 5′ ccagtgccaagccgacaaaatatcat 3′ R: 5′ cggacaacagagtgcggaccc 3′	144
6	Fregilis	F: 5′ aaggaagaatatgaggtggctgagatgg 3′ R: 5′ gcccaggcagcagaagttcatgaagagt 3′	153
7	c-Kit	F: 5′ gcgcctgccgaaatgtatgacg 3′ R: 5′ tgtgcttggtgctgtccgagatct 3′	121
8	Daz	F: 5′ gggcggcctggactggagtac 3′ R: 5′ gcctcgagactggttggtggttttat 3′	115
9	Dazl	F: 5′ tgacgtggatgtgcagaagatagtaga 3′ R: 5′ tggcggaggaggaggattaaa 3′	145
10	Tex17	F: 5′ ggccacctagcaatcaccaactcagaga 3′ R: 5′ ttgggtggtgtgtgtgtgtgtctgatct 3′	140
11	Stra8	F: 5′ 5′ gccggatgctgaagaaggaggaa 3′3′ R: 5′ ccggcaacagagtgggagaggag3′	125
12	TP2	F: 5′ cgccgacgaagcaccccaaaac 3′ R: 5′ tccgcctcctgaccgcctttctct 3′	135

We checked in vitro differentiation potentiality of these cells. To induce osteogenic and chondrogenic differentiation, rMSCs were maintained in respective differentiation medium [For osteogenic: DMEM containing 10% FBS and Dexamethasone (10 nmol), β-glycerophosphate (10 mmol), L-ascorbic acid (0.3 mM); For chondrogenic: DMEM containing 10% FBS, Dexamethasone (100 nmol), Sodium pyruvate (1 mmol), L-ascorbic acid (50 µg/mL), TGF-β1 (10 ng/mL) and ITS (1%)]and maintained for 21 days with medium supplementation for every 72 h. The osteogenic and chondrogenic differentiations were confirmed by alizarin red and alcian blue cytochemical staining respectively.

Induction for germ cell-like cells differentiation

The semi confluent cells were cultured in MSC culture medium as mentioned earlier. Additionally, the medium was supplemented with 10^-6M ratinoic acid (RA, Sigma) and maintained at 37℃ in a humidified atmosphere of 5% CO₂ for 21 days. Medium was refreshed on every 3^rd days. We visualized the effects of retinoic acid treatment on rMSC in terms of morphological changes at various time periods as well as expressions of GC-specific genes, immunocytochemical staining followed by flow cytometry assay.

After 21 days of differentiation total RNA was extracted and cDNA was prepared as per the method mentioned earlier. Gene expression analysis was carried out using the Real-Time PCR System (Bio-Rad) with rat specific primers (Table 1) for the germ cell specific marker genes like Stella, Fragilis, c-Kit, Stra8, DAZL, Tex18, INGA6 and TP2. Size-fractionation of PCR products were done as per previously mentioned protocols.

In order to confirm the differentiation of rMSCs into GCs we performed immunostaining for GCs specific markers Stella and Fregilis. The cells were fixed and stained with specific antibodies as per our previously described method. Moreover, we checked the percentage of Stella and Fregilis positive cells in differentiated cell population. After 21 days of RA induction the cells were harvested by trypsinization. Cells for each marker were separately fixed, permeabilized, blocked followed by incubation with primary and secondary antibodies as per the standard staining protocol described earlier. Flow cytometer (FACS Calibur, BD Bioscience, USA) settings was done with unstained cells. Cells were gated by forward scatter and the contribution of unstained cells was removed in FITC signal detector channel. Data were analyzed by Cell Quest Pro software (BD Biosciences, USA).

Isolation and characterization of bone marrow derived rMSCs

Rat bone marrow derived cells were attached and proliferated onto the polystyrene coated plastic surface of culture flask within 3 days after seeding. Initially different morphology of round and spindle shape of these cells was visualized which on subsequent passage flattened further to became fibroblastic in shape. Expanded cells after four passages appeared morphologically homogenous (Fig. 1A). The average population doubling time was recorded 187.32h. CFU assay provided an evidence of its clonogenic capacity in culture system (Fig. 1B). In immunostaining cells were positive for MSCs surface markers CD 73, CD 90, and CD 105 (Fig. 1C). FACS study also evidenced that the cells were positive for CD 73 (85.73%), CD 90 (71.29%) and CD 105 (79.55%) (Fig. 1D). Further, gene expression revealed the distinct bands of those markers whereas no band was noticed for CD 45 (Fig. 1E). Cells were able to differentiate in vitro towards osteocytes, and chondrocytes. After osteogenic differentiation for 21 days prominent mineralized nodules were noticed in alizarin staining. Proteoglycan accumulation was noticed by alcian blue staining after 21 days of chondrogenic differentiation (Fig. 1F).

Figure 1.(A-F) Characterization of rMSCs. (A) Morphology of rMSC at different passage (a) P0, (b) P1, (c) P4 and (d) P6. (B) (a) growth curve and (b) CFU assay of rMSC. (C) Immunofluorescence staining of MSC specific surface markers CD 73, 90 and 105. (D) Values represent the mean percentage of positively stained cells as analyzed by flow cytometry. (E) Expression of MSC specific genes assessed by RT-PCR. (F) Differentiation potential of rMSCs into mesodermal lineages. (a) osteocytes (alizarin red staining), (b) chondrocytes (alcian blue staining). Scale bar = 100 μm.

In vitro differentiation of rMSCs into germ cell-like cells

After induction with retinoic acid (RA) supplemented medium morphological changes of rMSC at various time points was noticed. The morphological features in some of the cells were found to be changed from fibroblastic to germ cell-like cell in the culture (Fig. 2). Immunocytochemical staining for the germ cells markers like stella and fragilis were found positive in treated cells after 21 days of incubation (Fig. 3A). These positive cells were quantified by FACS analysis where we found that RA treatment led to the generation of 56.75% and 39.51% stella and fragilis positive cells, respectively (Fig. 3B). These two marker genes were also expressed in the cultured cells found by RT-PCR study. Moreover, we noticed the expression of other germ cell marker genes like DAZL, Tex18, INGA6 and TP2 (Fig. 3C and 3D).

Figure 2.In vitro differentiation of rMSC into germ cell-like cells on different days. (A) Control undifferentiated. (B) Differentiated with RA supplementation. Scale bar = 100 μm.

Figure 3.In vitro characterization of germ cell-like cells. (A) Immunofluorescence staining after treatment with RA for 21 days (Scale bar = 100 μm). (B) FACS analyses of rMSCs derived germ cells, labeled with FITC conjugated antibodies against Stella (56.75%) and Fragilis (39.51%). (C) Molecular characterization of rMSC differentiated cells into germ cells by Stella and Fragilis. (D) Molecular study of spermatogonial stem cells markers - DAZL, tex18, INGA6 and TP2.

Isolation and purification of rat MSCs are challenging due to its low abundance in bone marrow and unwanted growth of non-mesenchymal cells during in vitro cell culture (Eslaminejad et al., 2006). In the present study, spindle-shaped fibroblast-like cells from rat bone marrow were purified by continuous medium change at initial phases of culture. Thereafter, in subsequent passage cells displayed the characteristic spindle shaped morphology which is commonly found in mesenchymal stem cells (Meirelles and Nardi, 2003). The CFU assay demonstrates the capacity of cell to generate clones, a typical characteristic of stem cell populations which has been noticed in our in vitro culture system. Population doubling time i.e. the time taken by the cells in doubling their number indicated a highly proliferative nature of the isolated rat bone marrow MSCs. The isolated cells expressed specific mesenchymal stem cell markers positive for CD 73, CD 90, and CD 105 while negative for CD 45. They were able to differentiate into osteogenic and chondrogenic lineages in vitro. These are the basic characteristics commonly found in rat bone marrow MSCs (Asumda and Chase, 2011). Therefore, we presume that cell population isolated from rat bone marrow was of rMSCs which were used for our subsequent experiments.

The germ cell generation from MSCs of various sources has enormous potential in augmentation of animal reproduction. It renders the possibility to produce animals with superior genetic potential even if the elite animal stops its ability to produce viable gametes.

Retinoic acid is considered as a crucial signaling molecule for the development of vertebrates, in cell differentiation, proliferation and apoptosis (Miano and Berk, 2001; Salem et al., 2019). Moreover, RA plays a key role in morphogenesis, growth and differentiation during vertebrate embryogenesis, also considered as one of the important factors for initiating meiosis in differentiating germ cells (Bowles and Koopman, 2007; Maghami et al., 2018). Many studies have shown that germ-like cells can be derived from stem cells of different origins in combination with sertoli cell condition medium and various concentrations of RA and growth factors (Geens et al., 2011; Chen et al., 2012; Cakici et al., 2013; Xie et al., 2015; Ghasemzadeh-Hasankolaei et al., 2016). The appropriate concentration of RA in culture medium is a critical factor as at high concentration (10^-5 to 10^-6 M) it induces the formation of germ cells while its low concentration (10^-8 to 10^-9 M) promotes differentiation of MSCs towards smooth muscle and myocardial cells (Gejisen et al., 2004; Silva et al., 2009).

The sertoli cells of seminiferous tubules provide physical support to the developing germ cells and also produce many growth factors and cytokines which give metabolic support during germ cell differentiation (Cheng, 2009; Wang et al., 2015). Conditioned medium produced by culturing sertoli cells in vitro contains the effective factors TGF, IL-1, IL-2, IL-6, GDNF, IGF, bFGF and retinoic acid (Shamekh et al., 2008). Therefore, the sertoli cell-conditioned medium is preferred as an agent for in vitro differentiation of stem cells towards germ cells (Geens et al., 2011; Monfared et al., 2016). In recent studies sertoli cell-conditioned medium has been used along with RA and exogenous bioactive factors for the differentiation of mesenchymal stem cells to germ-like cells (Cortez et al., 2018; Maghami et al., 2018; Salem et al., 2019). But in our experiment, after incubation in DMEM medium supplemented only with RA a population of rat MSCs resembled to germ cells like morphological feature and also expressed some of the germ cell markers.

Stella is a germ cell specific gene expressed during the differentiation process of GCs and, is involved in triggering GC competence and specification of primordial GCs from their surrounding somatic cells (Saitou et al. 2002; Hayashi et al., 2007; Mark et al. 2008). Expression of this marker in differentiated MSCs has been documented by Nayerna et al. 2006 and Qiu et al. 2013. Fragilis or interferon-induced transmembrane protein 3 (ifitm3) is also a GC-specific marker and acts as an initiation factor of GCs specification and competence (Lange et al., 2003; Lacham-Kaplan, 2004). These two genes were noticed expressed after the differentiation protocol we followed. We emphasized on these two markers by immunophenotyping where 56.75% and 39.51% of cell population were found positive for Stella and Fragilis respectively. The expression of these markers in our study might be considered as the evidence of germ cell-like cell differentiation from rat MSCs.

We also checked the expression of some other germ cell specific markers viz. DAZL, tex18, INGA6, TP2 by RT-PCR analysis and observed their positive expression. These markers are reported to be expressed during GC generation from MSCs under appropriate in vitro conditions (Wang et al., 2001; Saitou et al., 2002). DAZL contributes to the preliminary primordial germ cell formation by limiting pluripotency and somatic differentiation (Chen et al., 2014; Niu et al., 2014), and continues its expression in various types of gonadocysts in pre-natal and post-natal testes (Brekhman et al., 2000). It is expressed initially in mitotic spermatogonia, reaches peak in the cytoplasm of pachytene spermatocytes and ended in mature spermatozoa formation (Niu et al., 2014). With these findings we could able to establish that differentiation of rat MSCs towards germ cell-like cells is possible by RA supplementation alone in DMEM medium.

MSCs have the capacity to differentiate into numerous cell types which justifies its applicability in cell based therapy. In this in vitro study we observed the effect of retinoic acid alone in MSC culture medium using rat bone marrow derived MSCs as cellular model. We could able to demonstrate that retinoic acid is the most essential chemical cue which alone in culture medium can propels the targeted differentiation of MSCs towards germ cell-like cells. The results opened up the possibilities of applying this simplified technique in prospective reproductive medicine.

None.

Conceptualization & investigation, K.K.; writing - review & editing, D.K., K.A.; methodology, S.P., A.P.M.; supervision, D.T.; supervision & conceptualization; B.S.

None.

Not applicable.

Not applicable.

Not applicable.

Not applicable.

No potential conflict of interest relevant to this article was reported.