Cadmium (Cd) is one of the most well-known toxic heavy metals prevalent in the environment. Cd is easily absorbed and accumulates in plants, aquatic organisms, and the food chain. In its natural state, Cd is a byproduct of zinc ores, commonly found in industrial materials, such as nickel-Cd batteries, computer components, and pigments (Thompson and Bannigan, 2008). Humans are exposed to Cd through ingestion of contaminated food and drinking water and inhalation of tobacco smoke, house dust, contaminated air, etc. Cd can have harmful effects on human health because of its long half-life (10-30 years) and low excretion rate (Jaishankar et al., 2014). Absorbed Cd accumulates in the human body and causes various diseases by deteriorating the function of the kidneys, lungs, brain, liver, etc. (Godt et al., 2006).

In recent years, the harmful effects of Cd-induced toxicity on the reproductive system have been reported. In males, short-term exposure to high doses of Cd caused severe testicular injury, hormonal imbalance, germ cell depletion, interstitial tissue damage, and disruption of the blood-testis barrier (Parizek and Zahor, 1956; Parizek, 1957). Exposure to low concentrations of Cd affected the concentration, motility, morphology, and fertility of sperm, as well as embryonic development (de Angelis et al., 2017; Zhao et al., 2017). Given the toxic effects of Cd on female reproduction, accumulation of Cd in the ovaries and follicular fluid inhibited the growth and development of follicles and increased the number of atretic follicles, resulting in ovulation failure (Wang et al., 2015; Zhang et al., 2017). During pregnancy, maternal exposure to Cd increased retardation of fetal development, implantation delay, spontaneous abortion, and birth defects (Tian et al., 2009; Ikeh-Tawari et al., 2013). Cd exposure impaired oocyte maturation, fertility, and embryonic development (Akar et al., 2018; Zhu et al., 2018; Gwon et al., 2023). It has been reported that the these negative effects are mainly due to oxidative stress caused by excessive reactive oxygen species (ROS) accumulation and breakdown of the antioxidant defense system, leading to mitochondrial dysfunction and apoptosis (Martino et al., 2017; Gwon et al., 2023).

Although studies have shown the effects of Cd exposure on the reproductive system, the toxic effects of Cd on embryonic development during preimplantation are unclear. In this study, we used porcine embryos as an experimental model to investigate the toxicity of Cd exposure on embryonic development. Pigs are one of the most suitable models for toxicology testing because their organ size, embryo morphology, and maternal mRNA composition is similar to that of humans (Swindle et al., 2012). In particular, the cycle of embryonic development in pigs and humans is similar (Kobayashi et al., 2017). We examined embryonic development and blastocyst quality following Cd exposure. In addition, we examined intracellular levels of reactive oxygen species and glutathione (GSH), as well as mitochondrial content and function, to investigate the mechanism of Cd toxicity.

Chemicals

Unless otherwise specified, all chemicals and reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Oocyte preparation and in vitro maturation (IVM)

Porcine ovaries were collected from a local slaughterhouse and transported under 38.5℃ conditions in 0.9% saline supplemented with 50 μg/mL streptomycin sulfate and 75 μg/mL benzyl-penicillin potassium G. Cumulus oocyte complexes (COCs) obtained by aspirating 3-8 mm follicles using an 18 gauge needle with a 10 mL syringe were washed with 0.9% saline containing 0.1% bovine serum albumin (BSA). For IVM, COCs were cultured in IVM medium (tissue culture medium 199 complemented with 10% porcine follicular fluid, 0.57 mM cysteine, 10 ng/mL epidermal growth factor, 25 μM B-mercaptoethanol, 10 IU/mL pregnant mare serum gonadotropin (HOR-272, Prospec, Israel), and 10 IU/mL human chorionic gonadotropin (HOR-250, Prospec) for 22 h at 38.5℃ in a CO₂ atmosphere. After maturation for 22 h, the COCs were matured for an additional 22 h in the same medium without hormones.

Parthenogenetic activation (PA) and in vitro culture (IVC)

Cumulus cells were removed by gentle pipetting in 0.1% hyaluronidase, and oocytes with first polar body were selected for PA. Selected metaphase II oocytes were placed in 15 μM of ionomycin (Dulbecco’s phophate-bufferd salin; DPBS; Gibco, Carlsbad, CA, USA) complemented with 60 μg/mL gentamicin sulfate salt, 75 μg/mL streptomycin sulfate, and 4 mg/mL BSA) for 5 min in the dark. Activated oocytes were cultured in IVC medium (porcine zygote medium-3 with 4 mg/mL BSA) supplemented with 5 μg/mL cytochalasin B and 2 mM 6-dimethylaminopurine in 5% CO₂ at 38.5℃ for 4 h. After 4 h, activated oocytes were transferred to IVC medium, and cleavage and blastocyst formation rates were evaluated on day 2 and 6, respectively.

Chemical treatment

Cd was dissolved in distilled water and then diluted with IVC medium to bring the final concentration to 0, 20, 40, and 60 μM, and the final distilled water concentration was < 0.1% in IVC medium.

CDX2 staining

Formalin-fixed blastocysts were washed three times with DPBS containing 0.1% polyvinyl alcohol (PBS-PVA). After washing, blastocysts were incubated in DPBS containing 1% Triton X-100 for 1 h at room temperature. The blastocysts were then blocked overnight at 4℃ with PBS-PVA containing 1 mg/mL BSA and then with 10% normal goat serum for an additional 1 h. Next, the blastocysts were then incubated with mouse monoclonal CDX2 antibody (Biogenex Laboratories, Inc., San Ramon, CA, United States) overnight at 4℃ and washed three times with PBS-PVA containing 1 mg/mL BSA. After washing, blastocysts were incubated for 1 h at room temperature with Alexa-Fluor-488-labeled goat anti-mouse IgG secondary antibody (1:200). Subsequently, blastocysts were washed three times with PBS-PVA containing 1 mg/mL BSA and placed on glass slides using Vectashield with DAPI (Vector Laboratories, Burlingame, CA, USA). Nuclear and CDX2-positive cells were evaluated using a fluorescence microscope (DMi8; Leica, Wetzlar, Germany).

TdT-mediated dUTP nick-end labelling (TUNEL) assays

Formalin-fixed blastocysts were washed three times with PBS-PVA, and permeabilized by incubation in DPBS containing 1% Triton X-100 for 1 h at room temperature. The blastocysts were then stained with fluorescein-conjugated dUTP and terminal deoxynucleotidyl transferase using the In Situ Cell Death Detection Kit (Roche, Basel, Switzerland) for 1 h at 38.5℃. Next, the blastocysts were washed three times with PBS-PVA and placed on glass slides using Vectashield with DAPI. Nuclear and apoptotic cell numbers were evaluated using a fluorescence microscope.

Measurement of ROS and GSH levels

The ROS and GSH levels were detected using CM-H2DCFDA (Invitrogen, Carlsbad, CA, USA) and CMF2HC (Invitrogen), respectively. The embryos were incubated in PBS-PVA containing 5 μM CM-H2DCFDA or 10 μM CMF2HC for 10 min and washed three times with PBS-PVA. The ROS and GSH were observed with fluorescence microscopy using 460 nm and 370 nm ultraviolet filters and fluorescence intensities were analyzed using ImageJ software (version 1.47; National Institutes of Health, Bethesda, MD, USA).

Analysis of mitochondrial contents, ROS, and membrane potential

The active mitochondrial contents, mitochondrial ROS, and the mitochondrial membrane potential was determined by MitoTracker Red CMXRos (Invitrogen), MitoSOX Red mitochondrial superoxide indicator (Invitrogen), and TMRM (Invitrogen). Formalin-fixed embryos were incubated in PBS-PVA with 200 nM MitoTracker, 200 nM TMRM, and 10 μM MitoSOX for 30 min. After incubation, the embryos were washed three times with PBS-PVA, observed using a fluorescence microscope, and fluorescence intensities were quantified by ImageJ software.

Real-time polymerase chain reaction (qRT-PCR)

mRNAs were extracted from embryos with a Dynabeads mRNA Direct Kit (Invitrogen) and reverse transcription was performed using the Prime Script RT Reagent Kit with gDNA Eraser (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. The Mx3000P QPCR system (Agilent, Santa Clara, CA, United States) and SYBR Premix Ex Taq (Takara Bio Inc.) were used for qRT-PCR and the reaction conditions were set at 95℃ for 5 min, 95℃ for 20 s, 60℃ for 20 s, and 40 cycles. The expression of each target gene was quantified relative to that of the endogenous control gene (GAPDH). Primers used in the study are listed in Table 1.

Table 1. Primer sequences for qRT-PCR.

Gene	Primer sequences	GenBank accession no.	Product size (bp)
SOD1	F: 5’- GGTGGGCCAAAGGATCAAGA -3’	NM_001190422.1	80
	R: 5’- TACACAGTGGCCACACCATC -3’
SOD2	F: 5’- GGTGGAGGCCACATCAATCA -3’	NM_214127.2	220
	R: 5’- AACAAGCGGCAATCTGCAAG -3’
CAT	F: 5’- TGTACCCGCTATTCTGGGGA -3’	NM_214301.2	119
	R: 5’- TCACACAGGCGTTTCCTCTC -3’
GPX1	F: 5’- TGGACATCAGGAAAATGCCAAG -3’	NM_214201.1	127
	R: 5’- GTGAGCATTTGCGCCATTCA -3’
POLG	F: 5’- GCTTCCCTCTGCACTACTCA -3’	XM_001927064.5	160
	R: 5’- TGCTCAAGACAGTGCTTCCT -3’
POLG2	F: 5’- GTCATCGACTCCTGTGGTGG -3’	XM_021066763.1	98
	R: 5’- AAGTTTGTTTCCCTTCCGGC -3’
SIRT1	F: 5’- GAGCAACAGGCCCTGATTTA -3’	NM_001145750.2	115
	R: 5’- TACAAGTCACATCGCCTTCG -3’
PGC1α	F: 5’- ACACCAAACCCACAGAGACC -3’	NM_213963.2	149
	R: 5’- CTTGGGGTCATTTGGTGACT -3’
CPT1β	F: 5’- TACCTGTCCGGGATCAATTC -3’	NM_001007191.1	130
	R: 5’- AGTAGGAGGAACCCGCTGTT -3’
GAPDH	F: 5’- CCCTGAGACACGATGGTGAA -3’	NM_001206359.1	127
	R: 5’- GGAGGTCAATGAAGGGGTCA -3’

F, forward; R, reverse..

Statistical analyses

All experiments were conducted with at least three repetitions, and statistical analysis was performed using the SigmaStat program. If the p-value was less than 0.05, it was considered statistically significant. The data from two groups were analyzed using Student’s t-test, and for data with three or more means, Tukey-Kramer test and one-way analysis of variance (ANOVA) were conducted.

Cd exposure impairs porcine embryonic development

To examine the effect of Cd on porcine embryonic development, we cultured PA embryos in culture media treated with 0, 20, 40, and 60 μM Cd for 6 d and evaluated rates of cleavage and blastocyst formation. Compared to the control, cleavage and blastocyst formation rates began to decrease significantly in the 40 μM Cd group, and blastocysts did not develop in the 60 μM Cd group (Fig. 1A to 1C). Development during post-blastulation was significantly delayed in the 40 μM Cd group; notably, the proportion of expanded blastocysts decreased in the 40 μM Cd group (Fig. 1D and 1E). Based on these findings, we selected 40 μM Cd for subsequent studies.

Figure 1.Effect of cadmium exposure during porcine embryonic development. (A) Bright-field images of embryos on days 2 and 6. Bar = 200 µm. (B) Cleavage rate and (C) blastocyst formation rate (0; n = 132, 20; n = 133, 40; n = 133, 60; n = 133). (D) Representative images of blastocysts at the early blastocyst (EB), middle blastocyst (MB), large blastocyst (LB), and expanded blastocyst (ExB) stages. Bar = 50 µm. (E) Proportion of various blastocyst stages (0; n = 47, 20; n = 50, 40; n = 24). Values with different superscript letters (a, b, and c) differ significantly (p < 0.05). Data are compiled from four independent experiments.

Cd exposure reduces blastocyst quality in porcine embryos

We examined the effect of Cd on blastocyst quality using CDX2 staining and TUNEL assay. CDX2 staining showed that the inner cell mass and trophectoderm cell number of the Cd group were significantly reduced compared with the control (Fig. 2A to 2C). TUNEL assay results showed that compared to the control, the Cd group had no difference in the number of apoptotic cells, significantly reduced total cell number, and significantly higher apoptosis rate (Fig. 2D to 2G).

Figure 2.Effect of cadmium exposure on porcine blastocyst quality. (A) Representative images of CDX2 staining of blastocysts. Bar = 100 µm. Quantification of the (B) inner cell mass and (C) trophectoderm cells (n = 33 per group). (D) Representative images of TdT-mediated dUTP nick-end labeling of blastocysts. Bar = 100 µm. Quantification of (E) total cells, (F) apoptotic cells, and (G) apoptosis rate (n = 30 per group). Values with different superscript letters (a and b) differ significantly (p < 0.05). Data are compiled from three independent experiments.

Exposure to Cd induces oxidative stress in porcine embryos

During embryonic development, oxidative stress is a key factor affecting embryo quality (Bain et al., 2011). To determine whether Cd treatment causes oxidative stress during porcine embryonic development, we measured intracellular ROS and GSH levels. The Cd group exhibited significantly higher ROS and lower GSH levels than the control group (Fig. 3A to 3D). Moreover, we compared the relative transcript level of antioxidant-related genes such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX), which play important roles in primary antioxidant defense systems (Wang et al., 2018). The expression levels of antioxidant-related genes in the Cd group were significantly lower than the control group (Fig. 3E).

Figure 3.Effect of cadmium exposure on reactive oxygen species (ROS) and glutathione (GSH) levels in porcine embryos. (A) Bright-field images and CM-H2DCFDA fluorescence images of day 2 embryos. Bar = 200 µm. (B) Quantification of ROS fluorescence intensity (n = 50 per group). (C) Bright-field images and CMF2HC fluorescent images of day 2 embryos. Bar = 200 µm. (D) Quantification of GSH fluorescence intensity (n = 50 per group). (E) Relative expression levels of antioxidant-related genes in day 2 embryos (n = 3 per group). Values with different superscript letters (a and b) differ significantly (p < 0.05). Data are compiled from three independent experiments.

Cd exposure negatively affects mitochondrial content and function in porcine embryos

Mitochondria generate cellular energy through oxidative phosphorylation during embryonic development (McBride et al., 2006). To investigate the impact of Cd on mitochondrial function during porcine embryonic development, we examined mitochondrial content and membrane potential using MitoTracker and TMRM staining, respectively. The Cd group showed significantly decreased MitoTracker and TMRM intensity levels compared with the control group (Fig. 4A to 4D). Moreover, we assessed mitochondrial ROS using MitoSOX staining. The Cd group showed significantly increased MitoSOX intensity compared with the control group (Fig. 4E and 4F). Consistently, the expression of mitochondrial genes was significantly lower in the Cd group than the control group (Fig. 4G).

Figure 4.Effect of cadmium exposure on mitochondrial function in porcine embryos. (A) Bright-field images and MitoTracker fluorescence images of day 2 embryos. Bar = 200 µm. (B) Quantification of MitoTracker fluorescence intensity (n = 50 per group). (C) Bright-field images and TMRM fluorescence images of day 2 embryos. Bar = 200 µm. (D) Quantification of TMRM fluorescence intensity (n = 52 per group). (E) Bright-field and MitoSOX fluorescence images of day 2 embryos. Bar = 200 µm. (F) Quantification of MitoSOX fluorescence intensity (n = 52 per group). (G) Relative expression of mitochondrial genes in day 2 embryos (n = 3 per group). Values with different superscript letters (a and b) differ significantly (p < 0.05). Data are compiled from three independent experiments.

Cd is a hazardous heavy metal that is widespread in the environment. Cd accumulates in organisms after passing through their respiratory and digestive tracts, because it has a long biological half-life and low excretion rate, causing harm to health (Jaishankar et al., 2014). Long-term exposure to Cd adversely affects various systems, such as the nervous, cardiovascular, skeletal, renal, hepatic, and respiratory systems (Rafati Rahimzadeh et al., 2017). Cd is an environmental endocrine disruptor, because it extensively harms mammalian reproduction (Iavicoli et al., 2009). However, the impact of Cd exposure during early embryonic development is unknown. In this study, we used porcine embryos to investigate how Cd exposure affects embryonic development during preimplantation. Our results showed that Cd exposure during porcine embryonic development negatively affected developmental competency, including cleavage and blastocyst formation rates, cell numbers, and cellular survival. Cd exposure induced intracellular redox imbalance and mitochondrial dysfunction, indicated by mitochondrial content and membrane potential. To our knowledge, this is the first report demonstrating that Cd exposure impairs early embryonic development in porcine embryos.

Given that the female reproductive system is highly sensitive to toxins, Cd severely affects female fertility. Studies have provided convincing evidence that Cd accumulates in the female reproductive tract, including the ovaries, oviducts, and placenta, which in turn results in the deterioration of female fertility (Thompson and Bannigan, 2008). Females tend to absorb and accumulate more Cd in their bodies than males because they have low iron stores during pregnancy (Hudson et al., 2019). In view of the toxic effect of Cd on embryonic development, Cd exposure showed a dose-dependent failure of developmental progression in rodents (Storeng and Jonsen, 1980). Consistently, Cd exposure significantly reduced cleavage and blastocyst formation rates in porcine embryos. Notably, exposure to Cd led to implantation delay, embryo loss at the implantation stage, and failure to maintain pregnancy, probably due to impaired blastocyst quality (Thompson and Bannigan, 2008). Our results showed that Cd exposure significantly delayed developmental kinetics during post-blastulation, and reduced cell number of the inner cell mass and trophectoderm, and decreased cellular survival rate compared with the control. These results suggest that Cd exerts harmful effects on porcine embryonic development.

Oxidative stress is generated by excess ROS, which is a byproduct of mitochondrial oxidative phosphorylation. Under healthy conditions, ROS can act as a secondary messenger and promote cellular proliferation (Ray et al., 2012). However, under pathological conditions, excessive ROS accumulation leads to oxidative stress, causing mitochondrial dysfunction and cell death (Peoples et al., 2019). Oxidative stress was shown to be one of the major causes of developmental defects in embryos (Jeon et al., 2023; Joo et al., 2023). Notably, oxidative stress is one of the main mechanisms of Cd-induced cellular dysfunction, DNA damage, and apoptosis. Cd induces oxidative stress by activating the formation of inositol triphosphate and calcium channels, which leads to the disruption of intracellular calcium homeostasis and ROS overexpression (Qu et al., 2022). This could be linked to physicochemical similarities between Cd and calcium, indicating that Cd acts as an endocrine disruptor (Choong et al., 2014). Moreover, although Cd cannot generate free radicals directly, its indirect role has been confirmed, it induces the production of superoxide anion, hydrogen peroxide, and nitric oxide (Dżugan et al., 2018). In addition, Cd impairs primary antioxidant defense systems by inhibiting the activity of antioxidant enzymes, including SOD, CAT, and GPX (Cuypers et al., 2010). The SOD converts superoxide radical into hydrogen peroxide, and then the CAT and GPX convert hydrogen peroxide into nontoxic molecules such as water and oxygen (Wang et al., 2018). This process permits the maintenance of normal cellular redox balance by blocking free radical formation. However, Cd might bind to the active sites of SOD and CAT, which can result in a change in protein structure and affect their activity (Adi et al., 2016). Moreover, Cd reduces the GPX activity by increasing peroxidative damage to polyunsaturated fatty acids (Patra et al., 1999). Consistently, we found that embryos exposed to Cd showed significantly higher intracellular ROS, lower intracellular GSH, and lower expression of antioxidant enzymes compared with the control. These results suggest that Cd exposure causes oxidative stress by overproducing ROS and disrupting the antioxidant defense system in porcine embryos.

Mitochondria are important for embryonic development because they regulate cellular energy metabolism through oxidative phosphorylation (McBride et al., 2006). Mitochondrial content and membrane potential are widely used as parameters of mitochondrial function (Komatsu et al., 2014). Mitochondria are important targets of Cd-induced oxidative stress, which disrupts mitochondrial biogenesis and function by disturbing mitochondrial structure, altering mitochondrial permeability transport by binding to protein thiols in the mitochondrial membrane, and inhibiting the respiratory chain reaction (Unsal et al., 2020). These mitochondrial injuries cause mitochondrial malfunction and damage mitochondrial homeostasis, resulting in insufficient energy supply for embryonic development (Kim et al., 2020). In this study, compared to the control, embryos exposed to Cd showed significantly increased mitochondrial ROS, decreased mitochondrial content and membrane potential, and decreased expression of mitochondrial genes. This may be partly responsible for the impairment of embryo development following Cd exposure.

In conclusion, we demonstrated that Cd exposure impairs porcine embryonic development. Cd-induced developmental defects correlated with oxidative stress and mitochondrial dysfunction. These findings provide insights into the toxicity of Cd exposure on mammalian embryonic development and highlight the importance of preventing Cd pollution.

None.

Conceptualization, M.J.K., S-B.J., P-S.J., S-K.C.; methodology, M.J.K., S-B.J., H-G.K., P-S.J.; investigation, M.J.K., S-B.J.; data curation, M.J.K., S-B.J., B-W.S., P-S.J.; writing—original draft preparation, M.J.K., S-B.J., P-S.J.; writing—review and editing, B-S.S., B-W.S., S-U.K., S-K.C.; supervision, P-S.J., S-K.C.; project administration, P-S.J., S-K.C.; funding acquisition, S-K.C.

This work was supported by a 2-Year Research Grant of Pusan National University.

Not applicable.

Not applicable.

Not applicable.

Not applicable.

No potential conflict of interest relevant to this article was reported.