JARB Journal of Animal Reproduction and Biotehnology

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663

Article Search

Short Communication

Article Short Communication
Split Viewer

Journal of Animal Reproduction and Biotechnology 2022; 37(1): 62-66

Published online March 31, 2022

https://doi.org/10.12750/JARB.37.1.62

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Identification of matrix metalloproteinases secreted by human hepatocarcinoma HepG2 cells

Young Jae Lee1 , Keun Cheon Kim1 , Jeong Mook Lim1,2 and Seung Tae Lee3,4,*

1Department of Agricultural Biotechnology, Seoul National University, Seoul 08826, Korea
2Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea
3Kustogen Inc., Chuncheon 24341, Korea
4Department of Applied Animal Science, Kangwon National University, Chuncheon 24341, Korea

Correspondence to: Seung Tae Lee
E-mail: stlee76@kangwon.ac.kr

Received: February 14, 2022; Revised: February 28, 2022; Accepted: March 2, 2022

To date, the development of anticancer drugs has been conducted using two-dimensional (2D) cell culture systems. However, since cancer cells in the body are generated and developed in three-dimensional (3D) microenvironments, the use of 2D anticancer drug screening can make it difficult to accurately evaluate the anticancer effects of drug candidates. Therefore, as a step towards developing a cancer cell-friendly 3D microenvironment based on a combination of vinylsulfone-functionalized polyethylene glycol (PEG-VS) with dicysteine-containing crosslinker peptides with an intervening matrix metalloproteinase (MMP)-specific cleavage site, the types of MMPs secreted from human hepatocarcinoma HepG2 cells, a representative cancer cell, were analyzed transcriptionally and translationally. MMP3 was confirmed to be the most highly expressed protease secreted by HepG2 cells. This knowledge will be important in the design of a crosslinker necessary for the construction of PEG-based hydrogels customized for the 3D culture of HepG2 cells.

Keywords: hepatocarcinoma cells, hydrogel, matrix metalloproteinase, three-dimension culture

Human body is organized three-dimensionally by a variety of cells (Cukierman et al., 2002; Abbott, 2003). Therefore, the occurrence, growth, and metastasis of cancers within a body occur in a three-dimensional (3D) microenvironment (Friedrich et al., 2007). Thus, in vitro maintenance of cancer cells in a 3D microenvironment is important for evaluating the cytological effects of specific substances. To date, the screening of anticancer drugs has generally been done in a two-dimensional (2D) microenvironment based on cell culture plates (Bhadriraju and Chen 2002; Arrondeau et al., 2010) due to a lack of techniques available to construct 3D cancer cell microenvironments. Thus, a platform that can implement a 3D microenvironment suitable for diverse types of cancer cells will be important for precise anticancer drug screening. As a step towards the development of human hepatocarcinoma HepG2 cell-friendly 3D microenvironments based on the conjugation of vinylsulfone-functionalized polyethylene glycol (PEG-VS) and dicysteine-containing peptides with an intervening matrix metalloproteinase (MMP)-specific cleavage site, we attempted to elucidate a peptide sequence cleaved specifically by MMPs secreted predominantly from HepG2 cells (Yun et al., 2013; Lim et al., 2016). For this, the transcription of different MMPs and their activities in HepG2 cells were analyzed.

Culture of human hepatocarcinoma cells

Immortalized human hepatocarcinoma (HepG2) cells were purchased from ATCC and cultured in the HepG2 culture medium consisting of low glucose Dulbecco’s Modified Eagle Medium (LG-DMEM; Welgene, Gyeongsan, Korea) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; Welgene) and 1% (v/v) penicillin-streptomycin solution (Welgene) at 37℃ under an atmosphere of 5% CO2 in air. The fresh medium was changed every second day. When the cultured HepG2 cells reached over 80% confluency, cells were dissociated with 0.25% trypsin-EDTA (Welgene) and then 5 × 105 HepG2 cells were replated into 60 mm culture dishes (SPL, Pocheon, Korea). Subculture was conducted at 6-day intervals.

Real-time polymerase chain reaction (RT-PCR)

According to the respective manufacturer’s instructions, extraction of total mRNA from cells was conducted using the RNeasyTM mini kit (Qiagen, Hilden, Germany), and synthesis of cDNA from the prepared mRNA was performed using the ReverTra Ace qPCR RT Master Mix with gDNA Remover kit (Toyobo, Osaka, Japan). Subsequently, transcriptional levels of genes were quantified with Prime Q-Mastermix (Genetbio, Nonsan, Korea) using a qTOWER3 (Analytikjena, Jena, Germany). Melting curve data was analyzed for identifying PCR specificity. The mRNA levels are presented as 2-ΔCt where Ct = threshold cycle for target amplification and ΔCt = Cttarget gene (specific genes for each sample) ? Ctinternal reference (β-actin for each sample). Primers were designed using Primer 3 software (Whitehead Institute/MIT Center for Genome Research, Cambridge, MA, USA) with the information of cDNA sequences obtained from GenBank. Table 1 shows general information and sequences of primers.

Table 1 . Oligonucleotide primers and PCR cycling conditions

GenesGenBank numberPrimer sequenceSize (bp)Temp (℃)

Sense (5’ > 3’)Anti-sense (5’ > 3’)
ACTBNM_001101.5GAGCGAGCATCCCCCAAAGTTTGGGAGAGGACTGGGCCAT16660
MMP1NM_002421GAGCAGATGTGGACCATGCCACCTGGGCCTGGTTGAAAAGC19960
MMP2NM_004530TGAGGACTACGACCGCGACAACATCTTTCCGTCACTGCGGC16860
MMP3BC074815CGAGCTGGATACCCAAGAGGCTTGGGAAAGCCTGGCTCCAT17560
MMP8NM_002424CCATTCTTTGGGGCTCGCTCCAGGGTTTGGGTGTGCTTGG18660
MMP9NM_004994GTTTGGAAACGCAGATGGCGGCATTGCCGTCCTGGGTGTA19560
MMP10NM_002425GGCTCTTTCACTCAGCCAACCTCAGATCCCGAAGGAACAG18260
MMP13NM_002427GGCGACTTCTACCCATTTGAGGTCCTTGGAGTGGTCAAGA19060

ACTB, actin beta; MMP, matrix metalloproteinases; Temp, temperature.



MMP antibody array

For preparing conditioned medium containing MMP proteins produced in HepG2 cells, cells with 80% confluency were cultured for 4 days in the fresh HepG2 culture medium and cell debris within the incubated culture medium was removed through centrifugation with the micro centrifuge Smart R17 plus (Hanil, Daejeon, Korea). In addition, HepG2 culture medium incubated for 4 days in HepG2 cell-free culture dishes was prepared as a negative control. Subsequently, the presence or absence of 7 MMP proteins (MMP1, MMP2, MMP3, MMP8, MMP9, MMP10, and MMP13) in each medium was confirmed with Human MMP Antibody Array (ab-134004; Abcam?, Cambridge, UK) using with chemiluminescence imaging system Ez-Capture Ⅱ (AE-9150; Atto, Tokyo, Japan), and ImageJ software (ver. 1.52a; NIH, Bethesda, MD, USA) was used for quantification of spots derived from each MMP protein.

Statistical analysis

All numerical data in each parameter was analyzed using the Statistical Analysis System (SAS) software (SAS Institute Inc., Cary, NC, USA). Comparisons among groups were conducted using a generalized linear model (PROC-GLM) in the SAS package. A p value of less than 0.05 was determined as a significant difference.

In a 3D cancer cell culture system using hydrogels based on PEG functionalized by vinylsulfone, interconnection between PEG-VS arms and the biodegradability of PEG-based hydrogels are essential for the successful formation of PEG-based hydrogels and construction of the microspace required for the proliferation of cancer cells inside the hydrogel. Therefore, a crosslinker should contain an amino acid sequence cleaved specifically by MMPs secreted by cancer cells, flanked by a cysteine at both ends.

As a step towards inserting MMP-specific cleavage peptide sequences into a crosslinker required for the construction of a 3D PEG-based hydrogel customized to HepG2 cells, we analyzed the types of MMPs released from HepG2 cells. Among seven MMP genes, MMP3 showed the highest level of transcription; decreased levels of transcription of the remaining genes were observed in the following order: MMP2 > MMP10 > MMP1 > MMP13 > MMP8 > MMP9 (Fig. 1). In addition, a quantitative analysis of MMP proteins released from HepG2 cells demonstrated that protein expression of MMP3 was the highest; decreased levels of protein expression of the remaining MMP proteins were observed in the following order: MMP13 > MMP10 > MMP9 > MMP1. Expression of MMP2 and MMP8 was not detected in HepG2 cells (Fig. 2). Thus, we confirmed that MMP3 is an active protease released from HepG2 cells, indicating that amino acid sequences cleaved specifically by MMP3 will be useful in the development of a crosslinker for a HepG2 cell 3D culture system.

Figure 1. Transcription of genes encoding matrix metalloproteinases (MMPs) in HepG2 cells. HepG2 cells were cultured for 6 days in HepG2 cell culture medium and the mRNA levels of MMPs (MMP1, MMP2, MMP3, MMP8, MMP9, MMP10, and MMP13) were quantitatively monitored using real-time PCR. MMP3 exhibited the highest mRNA level; the expression of the remaining MMP genes decreased in the following order: MMP2 > MMP10 > MMP1 > MMP13 > MMP8 > MMP9. Data are shown as the mean ± standard deviation (SD) of four independent experiments. *p < 0.05.
Figure 2. Identification of MMP proteins secreted by HepG2 cells. To prepare a conditioned medium including the MMP proteins released from HepG2 cells, fresh HepG2 culture medium was added to HepG2 cells at 80% confluency and incubated for 4 days (Conditioned medium). For the control, fresh HepG2 culture medium was incubated for 4 days in a HepG2 cell-free culture dish (Control medium). The different MMPs present in the conditioned medium were identified using a chemiluminescence immunoassay and quantified using ImageJ software. Five MMP proteins (MMP1, MMP3, MMP9, MMP10, and MMP13) were observed in the conditioned medium; two (MMP2 and MMP8) were not expressed. No MMP proteins were observed in the control condition. The protein level of MMP3 was the highest among the MMPs detected. The expression of the remaining MMPs decreased in the following order: MMP13 > MMP10 > MMP9 > MMP1. Data are shown as the mean ± SD of three independent experiments. *p < 0.05. ND, not detected; Pos, positive control; Neg, negative control.

MMPs are generally synthesized and secreted according to cell type (Elkington et al., 2009; Tandara and Mustoe 2011); MMPs also play a major role in the regulation of cell behaviors such as proliferation, migration, differentiation, angiogenesis, apoptosis, and host defenses (Sternlicht et al., 2000; Snoek-van Beurden and Von den Hoff 2005; Winer et al., 2018). In the case of hepatocellular carcinoma, MMP3 is specifically produced (Bodey et al., 2000; Naim et al., 2017) and it plays a pivotal role in the induction of tumor invasion, metastasis, and angiogenesis (Sternlicht et al., 2000; Monvoisin et al., 2002). Previous studies support the high level of secretion of MMP3 by HepG2 cells immortalized from a liver hepatocellular carcinoma.

MMP3 was shown to be the most highly expressed protease in HepG2 cells. This result will be important in the design of a crosslinker for a PEG-based hydrogel customized for the 3D culture of HepG2 cells.

Conceptualization, S.T.L. and J.M.L.; data curation, Y.J.L., K.C.K., S.T.L. and J.M.L.; formal analysis, Y.J.L. and K.C.K.; funding acquisition, Y.J.L., S.T.L. and J.M.L.; investigation, Y.J.L. and K.C.K.; methodology, S.T.L. and J.M.L.; project administration, S.T.L. and J.M.L.; resources, S.T.L. and J.M.L.; supervision, K.C.K., S.T.L. and J.M.L.; validation, Y.J.L., K.C.K., S.T.L. and J.M.L.; visualization, Y.J.L. and K.C.K.; writing - original draft, Y.J.L. and K.C.K.; writing - review & editing, S.T.L. and J.M.L.

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (Ministry of Science and ICT) (No. 2021050132).

This study was approved by the Kangwon National University Institutional Review Board (IRB) according to the guidelines of the Kangwon National University IRB committee (IRB approval no. KWNUIRB-2022-01-010).

  1. Abbott A. 2003. Cell culture: biology's new dimension. Nature 424:870-872.
    Pubmed CrossRef
  2. Arrondeau J, Gan HK, Razak AR, Le Tourneau C. 2010. Development of anti-cancer drugs. Discov. Med. 10:355-362.
    Pubmed CrossRef
  3. Bhadriraju K and Chen CS. 2002. Engineering cellular microenvironments to improve cell-based drug testing. Drug Discov. Today 7:612-620.
    Pubmed CrossRef
  4. Bodey B, Bodey B Jr, Kaiser HE. 2000. Immunocytochemical detection of MMP-3 and -10 expression in hepatocellular carcinomas. Anticancer Res. 20(6B):4585-4590.
    Pubmed
  5. Cukierman E, Yamada KM. 2002. Cell interactions with three-dimensional matrices. Curr. Opin. Cell Biol. 14:633-639.
    Pubmed CrossRef
  6. Elkington PT, Friedland JS. 2009. Analysis of matrix metalloproteinase secretion by macrophages. Methods Mol. Biol. 531:253-265.
    Pubmed CrossRef
  7. Friedrich J, Kunz-Schughart LA. 2007. Experimental anti-tumor therapy in 3-D: spheroids--old hat or new challenge? Int. J. Radiat. Biol. 83:849-871.
    Pubmed CrossRef
  8. Lim M, Kim Y, Shin Y, Oh KB, Hwang S, Kim Y, Ock SA. 2016. Evaluation of primary hepatocyte function using 2D or 3D culture method for primary rat hepatocytes. J. Emb. Trans. 31:169-177.
    CrossRef
  9. Monvoisin A, Bisson C, Si-Tayeb K, Balabaud C, Rosenbaum J. 2002. Involvement of matrix metalloproteinase type-3 in hepatocyte growth factor-induced invasion of human hepatocellular carcinoma cells. Int. J. Cancer 97:157-162.
    Pubmed CrossRef
  10. Naim A, Baig MS. 2017. Matrix metalloproteinases (MMPs) in liver diseases. J. Clin. Exp. Hepatol. 7:367-372.
    Pubmed KoreaMed CrossRef
  11. Snoek-van Beurden PA and Von den Hoff JW. 2005. Zymographic techniques for the analysis of matrix metalloproteinases and their inhibitors. Biotechniques 38:73-83.
    Pubmed CrossRef
  12. Sternlicht MD, Werb Z. 2000. The matrix metalloproteinase stromelysin-1 acts as a natural mammary tumor promoter. Oncogene 19:1102-1113.
    Pubmed KoreaMed CrossRef
  13. Tandara AA and Mustoe TA. 2011. MMP- and TIMP-secretion by human cutaneous keratinocytes and fibroblasts--impact of coculture and hydration. J. Plast. Reconstr. Aesthet. Surg. 64:108-116.
    Pubmed KoreaMed CrossRef
  14. Winer A, Mignatti P. 2018. Matrix metalloproteinase inhibitors in cancer therapy: turning past failures into future successes. Mol. Cancer Ther. 17:1147-1155.
    Pubmed KoreaMed CrossRef
  15. Yun JI, Lee ST. 2013. Effects of extracellular stimulation of different niche condition on the transcriptional regulation of matrix metalloproteinase genes in the mouse embryonic stem cells. Reprod. Dev. Biol. 37:79-83.
    CrossRef

Article

Short Communication

Journal of Animal Reproduction and Biotechnology 2022; 37(1): 62-66

Published online March 31, 2022 https://doi.org/10.12750/JARB.37.1.62

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Identification of matrix metalloproteinases secreted by human hepatocarcinoma HepG2 cells

Young Jae Lee1 , Keun Cheon Kim1 , Jeong Mook Lim1,2 and Seung Tae Lee3,4,*

1Department of Agricultural Biotechnology, Seoul National University, Seoul 08826, Korea
2Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea
3Kustogen Inc., Chuncheon 24341, Korea
4Department of Applied Animal Science, Kangwon National University, Chuncheon 24341, Korea

Correspondence to:Seung Tae Lee
E-mail: stlee76@kangwon.ac.kr

Received: February 14, 2022; Revised: February 28, 2022; Accepted: March 2, 2022

Abstract

To date, the development of anticancer drugs has been conducted using two-dimensional (2D) cell culture systems. However, since cancer cells in the body are generated and developed in three-dimensional (3D) microenvironments, the use of 2D anticancer drug screening can make it difficult to accurately evaluate the anticancer effects of drug candidates. Therefore, as a step towards developing a cancer cell-friendly 3D microenvironment based on a combination of vinylsulfone-functionalized polyethylene glycol (PEG-VS) with dicysteine-containing crosslinker peptides with an intervening matrix metalloproteinase (MMP)-specific cleavage site, the types of MMPs secreted from human hepatocarcinoma HepG2 cells, a representative cancer cell, were analyzed transcriptionally and translationally. MMP3 was confirmed to be the most highly expressed protease secreted by HepG2 cells. This knowledge will be important in the design of a crosslinker necessary for the construction of PEG-based hydrogels customized for the 3D culture of HepG2 cells.

Keywords: hepatocarcinoma cells, hydrogel, matrix metalloproteinase, three-dimension culture

INTRODUCTION

Human body is organized three-dimensionally by a variety of cells (Cukierman et al., 2002; Abbott, 2003). Therefore, the occurrence, growth, and metastasis of cancers within a body occur in a three-dimensional (3D) microenvironment (Friedrich et al., 2007). Thus, in vitro maintenance of cancer cells in a 3D microenvironment is important for evaluating the cytological effects of specific substances. To date, the screening of anticancer drugs has generally been done in a two-dimensional (2D) microenvironment based on cell culture plates (Bhadriraju and Chen 2002; Arrondeau et al., 2010) due to a lack of techniques available to construct 3D cancer cell microenvironments. Thus, a platform that can implement a 3D microenvironment suitable for diverse types of cancer cells will be important for precise anticancer drug screening. As a step towards the development of human hepatocarcinoma HepG2 cell-friendly 3D microenvironments based on the conjugation of vinylsulfone-functionalized polyethylene glycol (PEG-VS) and dicysteine-containing peptides with an intervening matrix metalloproteinase (MMP)-specific cleavage site, we attempted to elucidate a peptide sequence cleaved specifically by MMPs secreted predominantly from HepG2 cells (Yun et al., 2013; Lim et al., 2016). For this, the transcription of different MMPs and their activities in HepG2 cells were analyzed.

MATERIALS AND METHODS

Culture of human hepatocarcinoma cells

Immortalized human hepatocarcinoma (HepG2) cells were purchased from ATCC and cultured in the HepG2 culture medium consisting of low glucose Dulbecco’s Modified Eagle Medium (LG-DMEM; Welgene, Gyeongsan, Korea) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; Welgene) and 1% (v/v) penicillin-streptomycin solution (Welgene) at 37℃ under an atmosphere of 5% CO2 in air. The fresh medium was changed every second day. When the cultured HepG2 cells reached over 80% confluency, cells were dissociated with 0.25% trypsin-EDTA (Welgene) and then 5 × 105 HepG2 cells were replated into 60 mm culture dishes (SPL, Pocheon, Korea). Subculture was conducted at 6-day intervals.

Real-time polymerase chain reaction (RT-PCR)

According to the respective manufacturer’s instructions, extraction of total mRNA from cells was conducted using the RNeasyTM mini kit (Qiagen, Hilden, Germany), and synthesis of cDNA from the prepared mRNA was performed using the ReverTra Ace qPCR RT Master Mix with gDNA Remover kit (Toyobo, Osaka, Japan). Subsequently, transcriptional levels of genes were quantified with Prime Q-Mastermix (Genetbio, Nonsan, Korea) using a qTOWER3 (Analytikjena, Jena, Germany). Melting curve data was analyzed for identifying PCR specificity. The mRNA levels are presented as 2-ΔCt where Ct = threshold cycle for target amplification and ΔCt = Cttarget gene (specific genes for each sample) ? Ctinternal reference (β-actin for each sample). Primers were designed using Primer 3 software (Whitehead Institute/MIT Center for Genome Research, Cambridge, MA, USA) with the information of cDNA sequences obtained from GenBank. Table 1 shows general information and sequences of primers.

Table 1. Oligonucleotide primers and PCR cycling conditions.

GenesGenBank numberPrimer sequenceSize (bp)Temp (℃)

Sense (5’ > 3’)Anti-sense (5’ > 3’)
ACTBNM_001101.5GAGCGAGCATCCCCCAAAGTTTGGGAGAGGACTGGGCCAT16660
MMP1NM_002421GAGCAGATGTGGACCATGCCACCTGGGCCTGGTTGAAAAGC19960
MMP2NM_004530TGAGGACTACGACCGCGACAACATCTTTCCGTCACTGCGGC16860
MMP3BC074815CGAGCTGGATACCCAAGAGGCTTGGGAAAGCCTGGCTCCAT17560
MMP8NM_002424CCATTCTTTGGGGCTCGCTCCAGGGTTTGGGTGTGCTTGG18660
MMP9NM_004994GTTTGGAAACGCAGATGGCGGCATTGCCGTCCTGGGTGTA19560
MMP10NM_002425GGCTCTTTCACTCAGCCAACCTCAGATCCCGAAGGAACAG18260
MMP13NM_002427GGCGACTTCTACCCATTTGAGGTCCTTGGAGTGGTCAAGA19060

ACTB, actin beta; MMP, matrix metalloproteinases; Temp, temperature..



MMP antibody array

For preparing conditioned medium containing MMP proteins produced in HepG2 cells, cells with 80% confluency were cultured for 4 days in the fresh HepG2 culture medium and cell debris within the incubated culture medium was removed through centrifugation with the micro centrifuge Smart R17 plus (Hanil, Daejeon, Korea). In addition, HepG2 culture medium incubated for 4 days in HepG2 cell-free culture dishes was prepared as a negative control. Subsequently, the presence or absence of 7 MMP proteins (MMP1, MMP2, MMP3, MMP8, MMP9, MMP10, and MMP13) in each medium was confirmed with Human MMP Antibody Array (ab-134004; Abcam?, Cambridge, UK) using with chemiluminescence imaging system Ez-Capture Ⅱ (AE-9150; Atto, Tokyo, Japan), and ImageJ software (ver. 1.52a; NIH, Bethesda, MD, USA) was used for quantification of spots derived from each MMP protein.

Statistical analysis

All numerical data in each parameter was analyzed using the Statistical Analysis System (SAS) software (SAS Institute Inc., Cary, NC, USA). Comparisons among groups were conducted using a generalized linear model (PROC-GLM) in the SAS package. A p value of less than 0.05 was determined as a significant difference.

RESULTS AND DISCUSSION

In a 3D cancer cell culture system using hydrogels based on PEG functionalized by vinylsulfone, interconnection between PEG-VS arms and the biodegradability of PEG-based hydrogels are essential for the successful formation of PEG-based hydrogels and construction of the microspace required for the proliferation of cancer cells inside the hydrogel. Therefore, a crosslinker should contain an amino acid sequence cleaved specifically by MMPs secreted by cancer cells, flanked by a cysteine at both ends.

As a step towards inserting MMP-specific cleavage peptide sequences into a crosslinker required for the construction of a 3D PEG-based hydrogel customized to HepG2 cells, we analyzed the types of MMPs released from HepG2 cells. Among seven MMP genes, MMP3 showed the highest level of transcription; decreased levels of transcription of the remaining genes were observed in the following order: MMP2 > MMP10 > MMP1 > MMP13 > MMP8 > MMP9 (Fig. 1). In addition, a quantitative analysis of MMP proteins released from HepG2 cells demonstrated that protein expression of MMP3 was the highest; decreased levels of protein expression of the remaining MMP proteins were observed in the following order: MMP13 > MMP10 > MMP9 > MMP1. Expression of MMP2 and MMP8 was not detected in HepG2 cells (Fig. 2). Thus, we confirmed that MMP3 is an active protease released from HepG2 cells, indicating that amino acid sequences cleaved specifically by MMP3 will be useful in the development of a crosslinker for a HepG2 cell 3D culture system.

Figure 1.Transcription of genes encoding matrix metalloproteinases (MMPs) in HepG2 cells. HepG2 cells were cultured for 6 days in HepG2 cell culture medium and the mRNA levels of MMPs (MMP1, MMP2, MMP3, MMP8, MMP9, MMP10, and MMP13) were quantitatively monitored using real-time PCR. MMP3 exhibited the highest mRNA level; the expression of the remaining MMP genes decreased in the following order: MMP2 > MMP10 > MMP1 > MMP13 > MMP8 > MMP9. Data are shown as the mean ± standard deviation (SD) of four independent experiments. *p < 0.05.
Figure 2.Identification of MMP proteins secreted by HepG2 cells. To prepare a conditioned medium including the MMP proteins released from HepG2 cells, fresh HepG2 culture medium was added to HepG2 cells at 80% confluency and incubated for 4 days (Conditioned medium). For the control, fresh HepG2 culture medium was incubated for 4 days in a HepG2 cell-free culture dish (Control medium). The different MMPs present in the conditioned medium were identified using a chemiluminescence immunoassay and quantified using ImageJ software. Five MMP proteins (MMP1, MMP3, MMP9, MMP10, and MMP13) were observed in the conditioned medium; two (MMP2 and MMP8) were not expressed. No MMP proteins were observed in the control condition. The protein level of MMP3 was the highest among the MMPs detected. The expression of the remaining MMPs decreased in the following order: MMP13 > MMP10 > MMP9 > MMP1. Data are shown as the mean ± SD of three independent experiments. *p < 0.05. ND, not detected; Pos, positive control; Neg, negative control.

MMPs are generally synthesized and secreted according to cell type (Elkington et al., 2009; Tandara and Mustoe 2011); MMPs also play a major role in the regulation of cell behaviors such as proliferation, migration, differentiation, angiogenesis, apoptosis, and host defenses (Sternlicht et al., 2000; Snoek-van Beurden and Von den Hoff 2005; Winer et al., 2018). In the case of hepatocellular carcinoma, MMP3 is specifically produced (Bodey et al., 2000; Naim et al., 2017) and it plays a pivotal role in the induction of tumor invasion, metastasis, and angiogenesis (Sternlicht et al., 2000; Monvoisin et al., 2002). Previous studies support the high level of secretion of MMP3 by HepG2 cells immortalized from a liver hepatocellular carcinoma.

CONCLUSION

MMP3 was shown to be the most highly expressed protease in HepG2 cells. This result will be important in the design of a crosslinker for a PEG-based hydrogel customized for the 3D culture of HepG2 cells.

Acknowledgements

We thank the National Research Foundation of Korea for supporting our project.

Author Contributions

Conceptualization, S.T.L. and J.M.L.; data curation, Y.J.L., K.C.K., S.T.L. and J.M.L.; formal analysis, Y.J.L. and K.C.K.; funding acquisition, Y.J.L., S.T.L. and J.M.L.; investigation, Y.J.L. and K.C.K.; methodology, S.T.L. and J.M.L.; project administration, S.T.L. and J.M.L.; resources, S.T.L. and J.M.L.; supervision, K.C.K., S.T.L. and J.M.L.; validation, Y.J.L., K.C.K., S.T.L. and J.M.L.; visualization, Y.J.L. and K.C.K.; writing - original draft, Y.J.L. and K.C.K.; writing - review & editing, S.T.L. and J.M.L.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (Ministry of Science and ICT) (No. 2021050132).

Ethical Approval

This study was approved by the Kangwon National University Institutional Review Board (IRB) according to the guidelines of the Kangwon National University IRB committee (IRB approval no. KWNUIRB-2022-01-010).

Consent to Participate

Not applicable.

Consent to Publish

Not applicable.

Availability of Data and Materials

Not applicable.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Transcription of genes encoding matrix metalloproteinases (MMPs) in HepG2 cells. HepG2 cells were cultured for 6 days in HepG2 cell culture medium and the mRNA levels of MMPs (MMP1, MMP2, MMP3, MMP8, MMP9, MMP10, and MMP13) were quantitatively monitored using real-time PCR. MMP3 exhibited the highest mRNA level; the expression of the remaining MMP genes decreased in the following order: MMP2 > MMP10 > MMP1 > MMP13 > MMP8 > MMP9. Data are shown as the mean ± standard deviation (SD) of four independent experiments. *p < 0.05.
Journal of Animal Reproduction and Biotechnology 2022; 37: 62-66https://doi.org/10.12750/JARB.37.1.62

Fig 2.

Figure 2.Identification of MMP proteins secreted by HepG2 cells. To prepare a conditioned medium including the MMP proteins released from HepG2 cells, fresh HepG2 culture medium was added to HepG2 cells at 80% confluency and incubated for 4 days (Conditioned medium). For the control, fresh HepG2 culture medium was incubated for 4 days in a HepG2 cell-free culture dish (Control medium). The different MMPs present in the conditioned medium were identified using a chemiluminescence immunoassay and quantified using ImageJ software. Five MMP proteins (MMP1, MMP3, MMP9, MMP10, and MMP13) were observed in the conditioned medium; two (MMP2 and MMP8) were not expressed. No MMP proteins were observed in the control condition. The protein level of MMP3 was the highest among the MMPs detected. The expression of the remaining MMPs decreased in the following order: MMP13 > MMP10 > MMP9 > MMP1. Data are shown as the mean ± SD of three independent experiments. *p < 0.05. ND, not detected; Pos, positive control; Neg, negative control.
Journal of Animal Reproduction and Biotechnology 2022; 37: 62-66https://doi.org/10.12750/JARB.37.1.62

Table 1 . Oligonucleotide primers and PCR cycling conditions.

GenesGenBank numberPrimer sequenceSize (bp)Temp (℃)

Sense (5’ > 3’)Anti-sense (5’ > 3’)
ACTBNM_001101.5GAGCGAGCATCCCCCAAAGTTTGGGAGAGGACTGGGCCAT16660
MMP1NM_002421GAGCAGATGTGGACCATGCCACCTGGGCCTGGTTGAAAAGC19960
MMP2NM_004530TGAGGACTACGACCGCGACAACATCTTTCCGTCACTGCGGC16860
MMP3BC074815CGAGCTGGATACCCAAGAGGCTTGGGAAAGCCTGGCTCCAT17560
MMP8NM_002424CCATTCTTTGGGGCTCGCTCCAGGGTTTGGGTGTGCTTGG18660
MMP9NM_004994GTTTGGAAACGCAGATGGCGGCATTGCCGTCCTGGGTGTA19560
MMP10NM_002425GGCTCTTTCACTCAGCCAACCTCAGATCCCGAAGGAACAG18260
MMP13NM_002427GGCGACTTCTACCCATTTGAGGTCCTTGGAGTGGTCAAGA19060

ACTB, actin beta; MMP, matrix metalloproteinases; Temp, temperature..


References

  1. Abbott A. 2003. Cell culture: biology's new dimension. Nature 424:870-872.
    Pubmed CrossRef
  2. Arrondeau J, Gan HK, Razak AR, Le Tourneau C. 2010. Development of anti-cancer drugs. Discov. Med. 10:355-362.
    Pubmed CrossRef
  3. Bhadriraju K and Chen CS. 2002. Engineering cellular microenvironments to improve cell-based drug testing. Drug Discov. Today 7:612-620.
    Pubmed CrossRef
  4. Bodey B, Bodey B Jr, Kaiser HE. 2000. Immunocytochemical detection of MMP-3 and -10 expression in hepatocellular carcinomas. Anticancer Res. 20(6B):4585-4590.
    Pubmed
  5. Cukierman E, Yamada KM. 2002. Cell interactions with three-dimensional matrices. Curr. Opin. Cell Biol. 14:633-639.
    Pubmed CrossRef
  6. Elkington PT, Friedland JS. 2009. Analysis of matrix metalloproteinase secretion by macrophages. Methods Mol. Biol. 531:253-265.
    Pubmed CrossRef
  7. Friedrich J, Kunz-Schughart LA. 2007. Experimental anti-tumor therapy in 3-D: spheroids--old hat or new challenge? Int. J. Radiat. Biol. 83:849-871.
    Pubmed CrossRef
  8. Lim M, Kim Y, Shin Y, Oh KB, Hwang S, Kim Y, Ock SA. 2016. Evaluation of primary hepatocyte function using 2D or 3D culture method for primary rat hepatocytes. J. Emb. Trans. 31:169-177.
    CrossRef
  9. Monvoisin A, Bisson C, Si-Tayeb K, Balabaud C, Rosenbaum J. 2002. Involvement of matrix metalloproteinase type-3 in hepatocyte growth factor-induced invasion of human hepatocellular carcinoma cells. Int. J. Cancer 97:157-162.
    Pubmed CrossRef
  10. Naim A, Baig MS. 2017. Matrix metalloproteinases (MMPs) in liver diseases. J. Clin. Exp. Hepatol. 7:367-372.
    Pubmed KoreaMed CrossRef
  11. Snoek-van Beurden PA and Von den Hoff JW. 2005. Zymographic techniques for the analysis of matrix metalloproteinases and their inhibitors. Biotechniques 38:73-83.
    Pubmed CrossRef
  12. Sternlicht MD, Werb Z. 2000. The matrix metalloproteinase stromelysin-1 acts as a natural mammary tumor promoter. Oncogene 19:1102-1113.
    Pubmed KoreaMed CrossRef
  13. Tandara AA and Mustoe TA. 2011. MMP- and TIMP-secretion by human cutaneous keratinocytes and fibroblasts--impact of coculture and hydration. J. Plast. Reconstr. Aesthet. Surg. 64:108-116.
    Pubmed KoreaMed CrossRef
  14. Winer A, Mignatti P. 2018. Matrix metalloproteinase inhibitors in cancer therapy: turning past failures into future successes. Mol. Cancer Ther. 17:1147-1155.
    Pubmed KoreaMed CrossRef
  15. Yun JI, Lee ST. 2013. Effects of extracellular stimulation of different niche condition on the transcriptional regulation of matrix metalloproteinase genes in the mouse embryonic stem cells. Reprod. Dev. Biol. 37:79-83.
    CrossRef