Mesenchymal stem cells (MSCs) are of great interest for the use in regenerative medicine, since they have capabilities of multi-lineage differentiation, immunomodulation, and secretion of pro-regenerative factors. MSCs has an ability of immunomodulation through cell to cell contacts or secretion of soluble factors, making them ideal candidates for cell therapy to treat certain kinds of immune-mediated disorders (Nauta and Fibbe, 2007; Zhao et al., 2010; Petrie Aronin and Tuan, 2010). Therefore, the mechanisms through which MSCs exert their immunomodulatory functions in autoimmune diseases have been studied (Djouad et al., 2005; Augello et al., 2007).

MSCs can be easily isolated from RA patient’s synovial fluid, and they can be obtained during diagnosis or treatment of patients when clinicians confirm a diagnosis of RA without harming (Mochizuki et al., 2006). Moreover, synovial fluid is an important source of MSC for the immoderation therapy of rheumatoid arthritis (RA), facilitating systemic recovery from RA by regenerating cartilage or bone repair in damaged RA joints. However, there is a dramatic increase in cellular senescence in MSCs derived from synovial fluid of longstanding RA patients, which may induce the lost immunomodulatory properties of those MSCs (Lee et al., 2021). Therefore, it is necessary to improve the immunomodulatory property of MSC derived from RA patients with reduced this function. Recently, studies of three-dimensional culture systems have been conducted for the effective application by enhancing the potential of MSCs as we mimick the in vivo microenvironment and increasing cell-to-cell interaction (Cheng et al., 2012; Guo et al., 2014). In this study, we evaluated and compared the effects of the MSCs in two different culture systems, three-dimensional (3D) culture systems and 2D-culture systems. Compared with 2D-cultured MSCs, 3D-cultured MSCs have been demonstrated to show a more powerful therapeutic effect for various disease, including brain stroke, peritonitis, and myocardial infarction (Guo et al., 2014; Wang et al., 2009).

In the present study, we monitored morphological and cellular changes of MSCs derived from synovial fluid of longstanding RA joints over 13 years (RA-hMSCs) under 3D-cuture condition and the evaluated mRNA expression levels of anti-inflammatory and anti-tumorigenic molecules following exposure to RA synovial fluid.

All media and chemicals were purchased from Gibco (Invitrogen Corporation, Grand Island, NY, USA) and Sigma-Aldrich Chemical Company (St. Louis, MO, USA) unless otherwise specified. The MSC culture medium was advanced Dulbecco’s modified Eagle medium (ADMEM), supplemented with 10% of fetal bovine serum (FBS), 1% GlutaMax (Gibco), 10 ng/mL of basic fibroblast growth factor (bFGF), and 1.0% penicillin-streptomycin (10,000 IU and 10,000 μg/mL, respectively, Pen-Strep), The osmolarity was adjusted to 285 ± 5 mOsm/kg, and the pH was adjusted to 7.2.

Characterization of RA-hMSCs prior to 2D- or 3D-culture method

For this study, we used two different cell lines, RA-hMSCs-1 and -2, which we used in our previous report (Lee et al., 2021). In briefly, RA-hMSCs were isolated from SF from the femorotibial joint of RA patients with chronic inflammation (average 13.8 years) and authorized by the IRB (Approval number GNUH 2012-05-009) at Hospital of Gyeongsang National University. We performed all experiments using both cell lines in consideration of differences between patient-derived cell lines.

RA-hMSCs were confirmed maintain characterics of MSC by MSC-specific cell surface markers of RA-hMSCs were analyzed by flow cytometry analysis (BD FACS Calibur; Becton Dickinson Franklin Lakes, NJ, USA). A total of 1 × 10₄ cells were harvested and fixed with 4% paraformaldehyde at 4℃. All antibodies were diluted (1:200) with 1% bovine serum albumin. Fluorescein isothiocyanate (FITC)-conjugated primary antibodies were incubated with the harvested cells for 1 h, with mouse IgG1-FITC used as an isotype control.

Approximately ~80% of confluent RA-hMSCs are differentiated into adipocytes and osteoblasts after 3 weeks. Adipogenesis was induced with Advanced Dulbecco’s modified Eagle’s medium (ADMEM) supplemented with 10% FBS, 10 µM insulin, 200 µM indomethacin, 500 µM isobutyl methylxanthine, and 1 µM dexamethasone for 28 d. Then, adipogenesis was confirmed by intracellular lipid vacuole staining with 0.5% Oil red O solution. And, osteogenesis was induced with ADMEM containing 10% FBS, 1 µM dexamethasone, 10 mM sodium β-glycerophosphate and 100 µM ascorbic acid for 28 d. Then, osteogenesis was determined by the accumulation of calcium deposits visualized with Alizarin-red S solution.

Cell proliferation assay

To evaluate the cell proliferation capacity, ~1 × 10³ cells at passage 3-5 were suspended in 500 μL of ADMEM, supplemented with 10% FBS and cultured for 14 d, and the culture medium was changed every 3 d. Cells were harvested with 0.25% trypsin EDTA every 2 d and counted in triplicate with flow cytometry.

Spheroid generation

RA-hMSCs were plated as hanging drops on an inverted culture dish lid in 30µL of ADMEM containing 25,000 cells/drop. The lid was flipped and placed on a culture dish containing PBS to prevent evaporation. Hanging drop cultures were grown at 37℃ up to 3 d in a humidified atmosphere with 5% CO₂.

Synovial fluid treatment

2D-monolayer cells were cultured in ADMEM supplemented with 20% synovial fluid of longstanding RA patients for 48 h. And 3D-spheroid cells were cultured in ADMEM supplemented with 20% synovial fluid of longstanding RA patients for 48 h using low attachment plates.

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis

Total RNAs were extracted by using RNeasy mini Kit (Qiagen) and quantified by using the OPTIZEN 3220 UV BIO Spectrophotometer. Reverse transcription of 1 µg total RNAs were performed by using Omniscript Reverse Transcription Kit (Qiagen) with oligo dT primer (Invitrogen) at 60℃ for 1 h.

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used for gene expression studies to determine pluripotency (OCT3/4, SOX2, and NANOG), anti-inflammatory genes (TSG-6, STC1 and LIF), anti-tumorigenic genes (IL-24, TRAIL), gene for an MSC homing receptor (CXCR4), and gene for Wnt signaling inhibitor (DKK1) using Rotor Gene SYBR green PCR kit (Qiagen). To evaluate lineage-specific gene expression, total RNA was extracted using a RNeasy mini kit (Qiagen, Valencia, CA, USA) and quantified by using an OPTIZEN 3220 UV BIO spectrophotometer (Mecasys Co., Ltd., Korea). To synthesize cDNA, reverse transcription was performed from 1 µg total RNA using an Omniscript Reverse Transcription Kit (Qiagen) with oligo dT primer (Invitrogen) at 60° C for 1 h. Relative qRT-PCR was performed using LightCyclerTM with FastStart DNA Master SYBR Green I (Roche), which consists of 2 mM of MgCl2, 2 µL of SYBR Green, and 0.5 µM each of forward and reward primers. The amplification program consists of denaturation at 95℃ for 1 min; 40 PCR cycles at 95℃ for 10 sec, 60℃ for 6 sec and 72℃ for 4 sec; melting curve from 65℃ to 95℃ by 0.1℃ per sec; cooling at 40℃ for 30 sec. All transcriptional levels of target genes were normalized against a housekeeping gene, YWHAZ.

We evaluated anti-inflammatory and anti-tumorigenic genes. qRT-PCR was performed in triplicate for YWHAZ, TSG-6, STC1, LIF, IL-24, TRAIL, CXCR4 and DKK1 (Table 1) using Rotor Gene SYBR green PCR kit (Qiagen).

Table 1. qRT-PCR primer sequence of anti-inflammatory and anti-tumorigenic-related genes.

Target Gene	Sequence	Accession number	Base pair
YWHAZ	F: CGAAGCTGAATCAGGAGAAG R: TTTGTGGGACAGCATGGTG	NM_003406.3	111
TSG-6	F: CAGGCTTCCCAAATGAGTACGA R: CCTGGGTCATCTTCAAGGTCAA	NM_007115.3	115
STC1	F: GGTGCTCCACTTTCCAAAGGAT R: CTCAGTGATGGCTTCAGGGTTC	NM_003155.2	104
LIF	F: ATCGTCCTCCTTGTCCCTGACT R: AGCTCCAACCCCACACACTATG	NM_002309.4	105
IL-24	F: GCTCTGGCTGAACTTTGTGG R: TCTGCAATAGCACTTATGTCATGG	NM_006850.3	133
TRAIL	F: CAGTAGTAGCCTCCAGGTTTCC R: CTCGTGATCTACCCACCTTGG	NM_003810.3	148
CXCR4	F: TCCTGGAAATCATCAAGCAAGG R: GGCTCCAAGGAAAGCATAGAGG	NM_001008540.1	125
DKK1	F: TGGAGAAGGTCTGTCTTGCC R: GGAGTTCACTGCATTTGGATAGC	NM_012242.2	112

Statistical analysis

One-way analysis of variance (ANOVA) with Tukey’s posthoc test was used to analyze differences among the treatments using SPSS software. Data is expressed as the mean ± standard deviation (SD), and differences were considered significant when p-values were less than 0.05. All data was presented as mean ± standard deviation (SD).

Cell surface markers for MSCs

Two different cell lines of hMSCs derived from longstanding RA-patients, RA-hMSCs-1 and -2 were maintained morphology of fibroblastic morphologies with plastic attachment ability and cell surface markers for RA-hMSCs were identified with flow cytometry using a BD FACS Calibur instrument (Fig. 1A). In briefly, RA-hMSCs-1 and -2 were identified in cells negative for hematopoietic stem cell markers (CD34 and CD45) and positive for MSC-specific markers (CD44, CD90 and CD105).

Figure 1.Characterization of RA-hMSCs. (A) Cell surface markers for RA-hMSCs were identified by FACS analysis, and were identified in cells positive for CD44, CD90, and CD105 and negative for CD34 and CD45. Data were presented as mean% ± SEM. (B) RA-hMSCs were differentiation induced into osteogenic and adipogneic lineages. Osteogenic induction was assessed by Alizarin red S staining of calcium deposition formation and adipogenic induction was assessed by Oil-red O staining of accumulated lipid vacuoles (scale bar, 100 μm).

Multilineage differentiation capacity of MSCs

RA-hMSCs-1 and -2 were verified by cytochemical staining from both sources progressed toward differentiation into adipocytes and osteocytes (Fig. 1B). It is confirmed by the cytoplasmic accumulation of lipid vacuoles and the deposition of calcified extracellular matrix by Oil red O and Alizarin red S staining.

Morphology change during RA-SF treatment culture of RA-hMSCs

We assessed morphology change of RA synovial fluid (RA-SF) non-treated RA-hMSCs as control and RA-SF treated hMSCs for 48 h. In non-treated control RA-hMSCs showed fibroblast-like morphology, but cellular debris was increased within the media of RA-hMSCs following treatment of RA-SF (Fig. 2).

Figure 2.Morphological changes in synovial fluid-treated RA-hMSCs. Although RA-hMSCs maintained the fibroblast-like morphology under in vitro culture conditions, unattached cells and cell debris increased in the medium during synovial treatment for 48 h (scale bar, 100 μm).

RA-hMSCs were generated spheroids using StemFIT culture dishes and cultured in hanging drops formed a loose network after 24 h. At 48 h, numerous small aggregates gradually were coalesced into a single central spheroid along the lower surface of the drop. Once spheroids are formed, it lasted up to 72 h (Fig. 3A). We re-isolated spheroid-forming RA-hMSCs into single cells by trypsin-EDTA treatment. The difference of 2D-monolayer and 3D-spheroid cultured hMSCs size was estimated by microscopy (Fig. 3B). The cells are released from spheroids after trypsinization and then the cells were estimated that they are nearly half the diameter and approximately one-fourth the volume of RA-hMSCs derived from 2D cultured. The mRNA levels of pluripotency related genes (OCT4, SOX2, and NANOG) in RA-hMSCs varied according to the culture methods (Fig. 3C). We analyzed the expression of pluripotency markers in both 2D and 3D cultured RA-hMSCs by RT-qPCR to confirm the effect of cells by 3D cultivation on the stemness of RA-hMSCs. Our results demonstrated that the expression of OCT4 and SOX2 was significantly (p < 0.001) increased in 3D cultured RA-hMSC groups when compared to 2D cultured RA-hMSCs.

Figure 3.Aggregation morphology expression of pluripotency related genes of 3D-spheroid RA-hMSCs. (A)Stereo microscope showing the time course of the aggregation of 25,000 RA-hMSCs into a spheroid in a hanging drop. Time-lapse microscopy demonstrated that RA-hMSCs cultured in hanging drops formed a loose network at 24h and then numerous small aggregate that gradually coalesced into a single central spheroid along the lower surface of the drop (scale bar, 500 μm). (B) The size of single cells derived from re-isolated 2D- and 3D-spheriod culture hMSCs were observed. The cells released from spheroids by trypsinization were nearly half the diameter and approximately one-fourth the volume of RA-hMSCs derived from 2D cultured. Arrows indicate single cells (scale bar, 100 μm). (C) Relative mRNA levels of pluripotent related genes (OCT4, SOX2, and NANOG) by qRT-PCR analysis from 2D cultured and 3D-spheroids cultured hMSCs. All data was normalized against YWHAZ and presented the mean ± SD (***p < 0.001).

Expression mRNA levels of anti-inflammatory and antitumorigenic molecules

We measured mRNA levels of anti-inflammatory genes (TSG-6, STC1 and LIF), anti-tumorigenic genes (IL-24, TRAIL), gene for an MSC homing receptor (CXCR4), and gene for Wnt signaling inhibitor (DKK1) from 3 types of RA-hMSCs; 2D-hMSCs, 2D-SF treated RA-hMSCs and 3D-SF treated RA-hMSCs by two different cell lines (Fig. 4A and B). In RA-hMSCs-1 and 2, the expression levels of TSG-6, STC1, LIF, IL-24, TRAIL, CXCR4 in 3D-spheroid cultured RA-hMSCs with SF treatment were significantly (p < 0.01 or p < 0.001) increased as compared to SF treated and non-treated 2D-monolayer cultured RA-hMSCs.

Figure 4.Expression of mRNA levels of anti-inflammatory and anti-tumorigenic molecules in 2D-monolayer and 3D-spheroid RA-hMSCs with SF treatments. Two different RA patients derived MSCs from synovial fluid, RA-hMSCs-1 (A) and -2 (B). The anti-inflammatory related genes (TSG-6, STC1 and LIF), anti-tumorigenic related genes (IL-24 and TRAIL), MSC homing receptors (CXCR4), and Wnt signaling inhibitor (DKK1) were evaluated in SF treated and non-treated 2D-monolayer cultured RA-hMSCs, SF treated 3D-shperiod RA-hMSCs by qRT-PCR analysis. All data was normalized against YWHAZ Values are mean ± SD (**p < 0.01, ***p < 0.001).

However, the expression patterns of DKK1 was observed cell line dependent difference between both RA-hMSCs. In RA-hMSCs-1, the mRNA level of DKK1 was significantly (p < 0.001) higher in SF treated and non-treated 2D cultured RA-hMSCs than in SF treated 3D-spheroid RA-hMSCs. However, SF treated 3D-spheroid RA-hMSCs-2 was significantly (p < 0.001) higher than in 2D cultured RA-hMSCs.

As autoimmune disease, RA therapy with MSC displays an improved multilineage differentiation and immunomodulation potential that repairs not only destructed cartilage or bones in affected joints but also ameliorates the autologous immune response to chronic systemic inflammation. SF-MSCs can be easily obtained as a cell source for stem cell treatment by aspirating SF with a needle and syringe from the joints of patients diagnosed as RA (Mochizuki et al., 2006; Jones et al., 2008; Sekiya et al., 2012). Up to this time, the immunosuppression potential of MSCs derived from synovial sources in the treatment of RA has not been investigated. Most studies that have investigated SF-MSCs have analyzed characterization of cells derived from OA or injured joints in patients who may have each different physiological case (Jones et al., 2008; Sekiya et al., 2012).

However, the incidence of RA increases rapidly in aged women who are at onset of the menopause (Talsania and Schofield, 2017). In our pervious study, longstanding RA patient derived MSCs lost immunomodulatory property and increased cellular senescence with chronic inflammation (Lee et al., 2021), so these patient-derived MSCs require stemness recovery for improvement of immunomodulation property. Therefore, we established 3D-spheroid forming system of cellular senescence increased RA-hMSCs derived from longstanding RA patients for increasing of ant-inflammation and anti-tumorigenic related genes.

MSCs dissociated from spheroids provide extremely small activated cells that could have major advantages for i.v. administration. As cells cultured with 2D did not show capacity of supporting a proper microenvironment for them (Bara et al., 2014), a microenvironment of conditions of being cultured is important for the decision of cell fate (Mason et al., 2011; Tsai et al., 2015). Thus, many studies have focused on 3D culture system of MSCs to maintain and enhance stemness along with pluripotent characteristics of MSCs (Bartosh et al., 2010). MSCs aggregate with each other in 3D culture conditions to form efficient spheroids and have cellular niches similar to in vivo conditions (Mason et al., 2011; Tsai et al., 2015).

In the present study, we successfully generated RA-hMSCs spheroids using StemFIT culture dishes and keep cultured in hanging drops formed for 72 h. These spheroid-formed cells were re-isolated after 72 h, reduced in size and changed to more round intact shape than in 2D-monolyaere culture. Morphological changes in cells to large and irregular shapes mean that the quality of cells is poor. Moreover, the size of MSCs has been critically considered in clinical applications after intravascular injection (i.v.) (Ge et al., 2014). The size of the i.v. injected MSCs should be smaller than the inner diameter of the peripheral vessels to prevent significant vascular occlusion, which can have serious consequences.

The 3D-spheroid formation of MSCs by aggregation is one of the useful methods to enhance the valuable therapeutic potential in terms of enhancement of stemness, immunomodulatory, and anti-inflammatory properties, and chemotaxis for homing (Jauković et al., 2020). Many different methods have been reported for preparing MSC spheroids, including hanging drop (Huang et al., 2020), concave micro-well aggregation (Hsu et al., 2013; Lee et al., 2016) and gravity circulation (Imura et al., 2018) methods. The expression levels of OCT4 and SOX2 were increased in 3D-shperoid formed RA-hMSC groups and indicating these cells have comparatively greater pluripotency. OCT4 is a most important transcription factors in stem cell for maintaining pluripotency and highly expressed in healthy MSCs with SOX2 and NANOG. Therefore, we can suggest that the pluripotency of RA-hMSCs derived from longstanding RA patients will be enhanced by the 3D-shperiod culture method. Moreover, the mRNA levels of anti-inflammatory genes (TSG-6, STC1 and LIF), anti-tumorigenic genes (IL-24, TRAIL) and gene for an MSC homing receptor (CXCR4) were dramatically increased in 3D-shperiod cultured RA-hMSCs with SF treatment in both RA-hMSCs derived from two different patients. However, the expression levels of DKK1 as Wnt signaling inhibitor which decreased in RA-hMSCs-1 but we observed increasing in 3D-spheriod formed RA-hMSCs-2 as the other cell line. DKK-1 is known to regulate the initiation of Wnt signaling as an inhibitory factor on tumor cell proliferation (Byun et al., 2005; Mao et al., 2001), which competes with Wnt for binding to LRP5/6 and inhibits activation of the Wnt signaling pathway (Brott and Sokol, 2002). RA-hMSCs-1 and -2 were derived from synovial fluid in the articular joints of two different RA patients and had disease duration matching (~14 years), but may differ in pathogenicity or bone metabolic status. Therefore, the effect on the expression regulation of DKK1 is presumed to be due to the 3D-shperiod aggregation and SF treatment in both cell lines.

Based on these results, we hypothesize that RA-hMSCs can be activated non-chemically in hanging drops to increase expression levels of pluripotent related genes, anti-inflammatory genes and anti-tumorigenic genes. Therefore, the 3D-spheroid RA-hMSCs may have advantages for therapeutic applications in RA using MSCs derived from longstanding patients.

None.

Conceptualization, S-C.L., C-Y.H.; data curation, S-C.L., C-Y.H.; formal analysis, Y-H.C.; investigation, S-C.L., C-Y.H., W-J.L., T-S.K.; methodology, S-C.L., C-Y.H., W-J.L.; project administration, S-L.L.; resources, S-L.L., G-J.R.; supervision, G-J.R.; writing - original draft, S-C.L., C-Y.H.; writing - review & editing, S-L.L.

This study was supported by a grant from the National Research Foundation (NRF) of Korea, funded by the government of the Republic of Korea (grant no. NRF-2021R1A2C1007054).

Not applicable.

Not applicable.

Not applicable.

Not applicable.

No potential conflict of interest relevant to this article was reported.