In chickens, the embryonic developmental process is quite different from that in mammals (Lee et al., 2007). The first cleavage begins 4 h after fertilization, as the embryos enter the magnum of the reproductive duct (Perry, 1987), but the first differentiation does not start, and only proliferation continues until Eyal-Giladi and Kochav (EGK) stage X. After oviposition, stage X embryos consist of 40,000 to 60,000 undifferentiated embryonic cells (Eyal-Giladi and Kochav, 1976). Furthermore, early studies reported that EGK stage X blastoderm cells will contribute to the somatic and germline when transplanted into recipient embryos to form chimeras (Petitte, 1990; Watanabe, 1992). Thus, the cell is a unique source for the establishment of pluripotent stem cells.

Chicken embryonic stem (ES) cells derived from EGK stage X chick embryos were established by Pain. However, they had low germline transmission compared to other germline cells (Pain et al., 1996). To date, the regulatory mechanism(s) regarding the genetic and epigenetic modulation of pluripotency in avian species have yet to be investigated in detail. Most recently, a set of studies have reported the generation of induced pluripotent stem (iPS) cells from various sources in avian species and the development of CRISPR/Cas9-mediated NANOG knock-in reporter DF1 cells that could trace pluripotent acquisition and maintenance (Su et al., 2020; Lee et al., 2023). Therefore, the development and characterization of a reliable method for the efficient isolation and robust expansion of chicken ES cells is needed.

In this study, we successfully generated chicken embryonic stem cell-like cells through co-culture with mouse embryonic fibroblasts. Furthermore, we investigated the expression of pluripotent markers and their functionality using siRNA-mediated knockdown. Finally, this study will facilitate potential use for various purposes, such as biobanking genetic materials and understanding embryogenesis and pluripotency in the fields of animal biotechnology.

Isolation and cultivation of EGK stage X blastoderm-derived singularized cells

Freshly laid unincubated eggs from White Leghorn (WL) chickens were used. Then, the eggs were opened at the blunt end, and the yolk was separated from the albumen. For EGK stage X blastoderm isolation, the yolks were transferred onto sterile Petri dishes and cleaned of albumen remains. EGK stage X blastoderm was separated from the egg using sterilized paper, and the shell membrane and albumen were detached from the yolk. A piece of square-type filter paper (Whatman, Maidstone, Kent, UK) with the hole at the center was placed over the germinal disc. After cutting around the paper containing the intrauterine embryo, it was gently turned over and the germinal disk was transferred to saline buffer. EGK stage X blastoderm was singularized by gentle pipetting in 0.05% (v/v) trypsin supplemented with 0.53 mM EDTA and then retrieved by centrifugation at 1,250 rpm for 5 min for cultivation of chicken embryonic stem cell-like cells. After isolation, EGK stage X blastoderm-derived singularized cells were co-cultured on mitotically inactivated CF1 MEFs in chicken ES medium at 37℃ in a humidified 5% CO₂ incubator. Chicken ES medium consisted of KO-DMEM (Gibco, Grand Island, USA) supplemented with 20% KnockOut Serum Replacement (Gibco, USA), 1× Non-Essential Amino Acid (Gibco, USA), 10 ng/mL recombinant human Leukemia inhibitory factor (Sigma‒Aldrich, St. Louis, USA), 0.1 mM β-mercaptoethanol (Gibco, USA), 2 mM L-glutamine (Gibco, USA) and 1× antibiotic-antimycotic solution (Gibco, USA). The medium was replaced on alternate days, and chicken embryonic stem cell-like cells were passaged every 7 days by gentle pipetting without disturbing the feeder cells.

Preparation of CF1 mouse embryonic fibroblasts (MEFs) as a feeder layer

CF1 MEFs (SCRC-1040; ATCC, Manassas, USA) were maintained and subpassaged in DMEM (Invitrogen, Waltham, USA) supplemented with 15% FBS and 1× antibiotic-antimycotic solution. Cells were cultured in an incubator at 37℃ with 5% CO₂ and 60-70% relative humidity. MEFs at P3 were mitotically inactivated by treatment with mitomycin C (Sigma‒Aldrich, St. Louis, USA) for 3 h and only used for chicken embryonic stem cell-like cells as a feeder layer.

siRNA-mediated knockdown of the chicken NANOG gene in vitro

For targeted knockdown, NANOG-specific siRNA (5’-AAC UGU GUG AUA CUA UCA GUU-3’) was designed from unique regions and transfected into chicken embryonic stem cell-like cells using Lipofectamine RNAiMAX (transfection efficiency, >90%) (Lee et al., 2020). After knockdown of NANOG, chicken embryonic stem cell-like cells were monitored at 6 hr intervals for up to 48 hr and subjected to total RNA and cDNA preparation. Then, the expression of pluripotent markers and knockdown efficiency, as summarized in Table 1, was examined by quantitative RT‒PCR with the prepared cDNA samples. The morphological changes in chicken embryonic stem cell-like cells after siRNA-mediated knockdown were monitored daily under a microscope.

Table 1. Primers used for this study for the gene expression analysis of chicken embryonic stem cell-like cells.

No.	Gene ID	Gene Name	Forward	Reverse	Size (bp)
1	374193	GAPDH	CCTCTCTGGCAAAGTCCAAG	CATCTGCCCATTTGATGTTG	200
2	100272166	NANOG	ACCTTCAGGCTGTGACCAGT	GGTGCTCTGGAAGCTGTAGG	245
3	427781	Pou5f3	GAGGACCTCAACCTGGACAA	TTGTGGAAAGGTGGCATGTA	215
4	396105	SOX2	GATGGAAACCGAGCTGAAAC	TTGCTGATCTCCGAGTTGTG	201

Periodic acid-Schiff (PAS) and alkaline phosphatase (AP) staining

Chicken embryonic stem cell-like cells at P5 were used to assess the characteristics of stem cells using periodic acid-Schiff and alkaline phosphatase as described previously (Lee et al., 2023). Cells were collected and fixed in 50 mM phosphate buffer containing 2% (v/v) glutaraldehyde, 2% formaldehyde, and 2 mM MgCl₂ for 10 min at room temperature as previously described (Park et al., 2003). After rinsing in PBS, the cells were immersed in periodic acid solution (Sigma‒Aldrich, St. Louis, USA) for 15 min. The stained cells were observed under an inverted microscope. Alkaline phosphatase activity was detected by an alkaline phosphatase chromogen kit (Abcam, Cambridge, UK) according to the manufacturer’s instructions.

Quantitative RT‒PCR

Total RNA from prepared samples, including Eyal-Giladi and Kochav (EGK) stage X embryos and chicken embryonic stem cell-like cells, was isolated using TRIzol reagent (Life Technologies, Carlsbad, USA) as described previously (Lee et al., 2020; Lee et al., 2023), and quantitative RT‒PCR was performed to assess the expression of pluripotent markers, as summarized in Table 1. The PCR mixture was prepared by adding 2 μL of 10 pmol of each forward and reverse primer, 7 μL of nuclease-free water, 10 μL of SYBR Green qPCR Master Mix, and 1 μL of cDNA to a final volume of 20 μL. The relative gene expression was determined using the StepOnePlus^TM Real-Time PCR System (Applied Biosystems, Waltham, USA) and determined with a housekeeping gene (GAPDH) using the 2-^ΔΔCt method (Livak et al., 2001).

Statistical analysis

Differences between groups were analyzed statistically by one-way ANOVA or Student’s t test using GraphPad Prism V 6.0 software (GraphPad, San Diego, USA). The results are expressed as the mean ± standard error (n ≥ 3, where n is the number of replicates). A p value <0.05 was considered to indicate statistical significance.

Generation and characterization of chicken embryonic stem cell-like cells

Here, we report the generation of chicken embryonic stem cell-like cells under pluripotent culture conditions. First, we prepared mitotically inactivated CF1 mouse embryonic fibroblasts (MEFs) as a feeder layer. Next, we carefully isolated EGK stage X blastoderm from freshly laid unincubated eggs of White Leghorn (WL) chickens after oviposition to prevent egg yolk contamination and singularized them through gentle pipetting in 0.05% (v/v) trypsin supplemented with 0.53 mM EDTA. Subsequently, EGK stage X blastoderm-derived singularized cells were seeded on mitomycin C-treated MEFs. After 7 days of culture in chicken ES medium, chicken embryonic stem cell-like cells began to emerge as colonies and continuously proliferated, resulting in stable maintenance after several passages through co-culture. Experimental procedures regarding the generation of chicken embryonic stem cell-like cells are shown in Fig. 1. As shown in Fig. 1, chicken embryonic stem cell-like cells exhibited stem cell morphology, such as clear boundaries and spherical shapes, indicating that this culture condition promoted the growth potential for the establishment of embryonic stem (ES) cells from EGK stage X blastoderm-derived singularized cells. Furthermore, chicken embryonic stem cell-like cells at passage 5 (P5) expressed key stem cell markers such as alkaline phosphatase and periodic acid-Schiff (Fig. 2A). In addition, analysis of pluripotent gene expression showed that the endogenous Pou5f3, Sox2, and NANOG genes in chicken embryonic stem cell-like cells were more highly expressed than those in undifferentiated stage X embryos (Fig. 2B).

Figure 1.Experimental procedures regarding the generation of chicken embryonic stem cell-like cells. EGK stage X blastoderm-derived singularized cells were seeded on mitomycin C-treated MEFs. After 7 days of culture in chicken ES medium, chicken embryonic stem cell-like cells began to emerge as colonies and continuously proliferated. The white dotted circle indicates chicken embryonic stem cell-like cells. Scale bar: 100 μm.

Figure 2.Characterization of chicken embryonic stem cell-like cells. (A) Chicken embryonic stem cell-like cells at passage 5 (P5) showed stem cell morphology and positive staining of key stem cell markers, including alkaline phosphatase and periodic acid-Schiff. Scale bar: 100 μm. (B) The endogenous Pou5f3, Sox2, and NANOG genes in chicken embryonic stem cell-like cells showed higher expression than those in undifferentiated stage X embryos. All data are expressed as the mean ± standard error from three independent experiments. A p value <0.05 was considered to indicate statistical significance.

Effect of siRNA-mediated knockdown of chicken NANOG

To characterize the cellular potential of chicken embryonic stem cell-like cells, we investigated the effect of siRNA-mediated NANOG knockdown. NANOG, as a transcription factor, plays pivotal roles in maintaining stemness in pluripotent stem cells, such as induced pluripotent stem cells and embryonic stem cells (Fuet et al., 2018). Interestingly, we found that chicken embryonic stem cell-like cells at 48 hr post transection showed severe changes in morphology compared to the control (Fig. 3A), suggesting that chicken embryonic stem cell-like cells have the key characteristics of embryonic stem cells. Furthermore, we examined knockdown efficiency and pluripotent gene expression. As shown in Fig. 3B, the designed siRNA that targets chicken NANOG was effective in lowering gene expression; therefore, this siRNA was used for further experiments. Moreover, we evaluated pluripotent gene expression. After 48 hr of chicken NANOG knockdown, pluripotency marker genes (Sox2 and Pou5f3) were significantly decreased compared to the control (Fig. 3B). Together, these results clearly demonstrated that NANOG plays a key role in maintaining the pluripotency of chicken embryonic stem cell-like cells, as reported in other species.

Figure 3.siRNA-mediated knockdown of chicken NANOG in chicken embryonic stem cell-like cells shows severe changes in morphology. (A) After 48 hr of chicken NANOG knockdown, chicken embryonic stem cell-like cells were monitored at 6 hr intervals for up to 48 hr. The white dotted circle indicates damaged chicken embryonic stem cell-like cells. Scale bar: 100 μm. (B) The endogenous Pou5f3 and Sox2 genes in chicken embryonic stem cell-like cells after 48 hr of chicken NANOG knockdown were significantly decreased compared to the control. All data are expressed as the mean ± standard error from three independent experiments. A p value <0.05 was considered to indicate statistical significance.

Chicken embryonic stem (ES) cells have great potential and provide a powerful tool to investigate embryonic development and to manipulate genetic modification in a genome. Since the first report in 1996 (Pain et al., 1996), studies on chicken ES cells are relatively rare compared to other species due to low germline transmission and egg yolk contamination although recent studies have reported the generation of induced pluripotent stem (iPS) cells from various sources in avian species. Therefore, the primary aim of this study was established a method to generate chicken embryonic stem cell-like cells under pluripotent culture conditions.

The key important issue to consider for the establishment of chicken embryonic stem cell-like cells is the growth factor constituting the medium of chicken ES cells to support pluripotent culture conditions. LIF has been shown to play a pivotal role in maintaining the proliferation and pluripotency of mouse and chicken ES cells in vitro (Smith, 1992; Pain et al., 1996). Furthermore, the maintenance of chicken ES cells in vitro requires a suitable environment. Therefore, we used LIF on growth factor and CF1 mouse embryonic fibroblasts (MEFs) as a feeder layer to create pluripotent culture conditions in this study, resulting in the growth potential for the generation of ES cells from EGK stage X blastoderm-derived singularized cells, as shown in Fig. 1. Furthermore, the generated chicken embryonic stem cell-like cells had stem cell morphology and expressed key stem cell markers (Fig. 2).

In addition, we investigated the functionality regarding the effect of siRNA-mediated NANOG knockdown. NANOG is a key factor for the induction of pluripotency to successfully reprogram avian somatic cells and controls stemness in chickens (Fuet et al., 2018; Lee et al., 2023). As a result, targeted knockdown of NANOG in chicken embryonic stem cell-like cells resulted in severe changes in morphology compared to the control (Fig. 3A) and a significant decrease in pluripotency marker genes such as Sox2 and Pou5f3 (Fig. 3B), suggesting that NANOG plays a key role in maintaining the pluripotency of chicken embryonic stem cell-like cells, as reported in other species. Evidently, this observation was in agreement with findings from a previous study of chicken iPS cells (Lee et al., 2023).

At this stage, we do not fully characterize the differentiation capacity of chicken embryonic stem cell-like cells in vivo and in vitro. However, our results demonstrate the efficient generation of chicken embryonic stem cell-like cells from EGK stage X blastoderm-derived singularized cells.

Given the increasing importance of chicken ES cells as a cell source, this study will facilitate their potential use for various purposes, such as biobanking genetic materials and understanding embryogenesis and pluripotency in the fields of animal biotechnology as well as basic bioscience research.

None.

Conceptualization, B.R.L.; methodology, data curation and formal analysis, B.R.L., H.Y.; writing-original draft preparation, B.R.L.; supervision, B.R.L.; funding acquisition and project administration, B.R.L. All authors have read and agreed to the published version of the manuscript.

This work was carried out with the support of “Animal Science & Technology Development (Project No. PJ01481702)” from National Institute of Animal Science (NIAS), Rural Development Administration (RDA), Korea.

The experimental use of White Leghorn (WL) chicken was approved by the Institutional Animal Care and Use Committee (IACUC) of the National Institute of Animal Science (NIAS- 2020-451), Korea.

Not applicable.

Not applicable.

The datasets during and/or analyzed during the current study are available from the corresponding authors upon reasonable request.

No potential conflict of interest relevant to this article was reported.