JARB Journal of Animal Reproduction and Biotehnology

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663

Article Search

Original Article

Article Original Article
Split Viewer

Journal of Animal Reproduction and Biotechnology 2023; 38(3): 99-108

Published online September 30, 2023

https://doi.org/10.12750/JARB.38.3.99

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Cadmium chloride down-regulates the expression of Rad51 in HC11 cells and reduces knock-in efficiency

Ga-Yeon Kim and Man-Jong Kang*

Department of Animal Science, College of Agriculture and Life Science, Chonnam National University, Gwangju 61186, Korea

Correspondence to: Man-Jong Kang
E-mail: mjkang@jnu.ac.kr

Received: August 9, 2023; Revised: August 16, 2023; Accepted: August 16, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background: Efficient gene editing technology is needed for successful knock-in. Homologous recombination (HR) is a major double-strand break repair pathway that can be utilized for accurately inserting foreign genes into the genome. HR occurs during the S/G2 phase, and the DNA mismatch repair (MMR) pathway is inextricably linked to HR to maintain HR fidelity. This study was conducted to investigate the effect of inhibiting MMR-related genes using CdCl2, an MMR-related gene inhibitor, on HR efficiency in HC11 cells.
Methods: The mRNA and protein expression levels of MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2), the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV were assessed in HC11 cells treated with 10 μM of CdCl2 for 48 hours. In addition, HC11 cells were transfected with a CRISPR/sgRNA expression vector and a knock-in vector targeting Exon3 of the mouse-beta casein locus, and treated with 10 μM cadmium for 48 hours. The knock-in efficiency was monitored through PCR.
Results: The treatment of HC11 cells with a high-dose of CdCl2 decreased the mRNA expression of the HR-related gene Rad51 in HC11 cells. In addition, the inhibition of MMR-related genes through CdCl2 treatment did not lead to an increase in knock-in efficiency.
Conclusions: The inhibition of MMR-related gene expression through high-dose CdCl2 treatment reduces the expression of the HR-related gene Rad51, which is active during recombination. Therefore, it was determined that CdCl2 is an inappropriate compound for improving HR efficiency.

Keywords: cadmium chloride, CRISPR-Cas9 mediated knock-in efficiency, DNA mismatch repair, homologous recombination, non-homologous end joining

Gene targeting is a useful technique for inserting foreign genes into a specific locus in the genome. The major pathways of double-strand break (DSB) repair are homologous recombination (HR) and non-homologous end joining (NHEJ). The HR pathway is utilized to accurately insert foreign genes into the genome, but it occurs only during the S/G2 phase, and its efficiency for DSB repair is lower than that of NHEJ (Vasquez et al., 2001; Mao et al., 2008). Thus, studies have been performed to improve the efficiency of HR for accurate gene targeting. The HR-related gene Rad51 is involved in strand invasion and mediates homologous DNA pairing (Long et al., 2011). The NHEJ-related gene DNA Ligase IV is crucial for ligating DNA ends resulting from DSBs in the NHEJ pathway (Ochi et al., 2012). SCR7, an inhibitor of the NHEJ-related gene DNA Ligase IV, has been reported to increase HR efficiency in mammalian cells by up to 19-fold (Maruyama et al., 2015). RS-1 is a chemical compound that stimulates Rad51 (Jayathilaka et al., 2008) and has been shown to increase knock-in efficiency in rabbit embryos by 25-fold (Song et al., 2016). However, the efficiency of gene targeting varies depending on the species or cell type, and further studies are needed for accurate gene targeting. Therefore, it is essential to examine DNA repair pathways closely related to the HR pathway.

The DNA mismatch repair (MMR) is known to be inextricably linked to HR (Spies and Fishel, 2015), and is reported as a post-replication repair pathway that occurs during replication or recombination (Li, 2008). The MMR-related MutS α (MSH2-MSH6) and MutS β (MSH2-MSH3) proteins bind to a mismatched DNA base pair, and MutL α (MLH1-PMS2) is an endonuclease that binds to MutS-heteroduplex complexes (Lahue et al., 1989; Habraken et al., 1996). The MMR maintains HR fidelity and prevents recombination between divergent sequences through heteroduplex rejection in the presence of extensive heteroduplexes during the recombination process (Goldfarb and Alani, 2005; Kunkel and Erie, 2015; Chakaraborty and Alani, 2016).

CdCl2 treatment inhibits ATP hydrolysis of MutS α (MSH2-MSH6) in eukaryotic cells and specific binding to mismatched DNA (Clark and Kunkel, 2004). Meanwhile, it has been reported that knock-out of Msh2 accelerates the DSB-promoted recombination by divergence substrates in gene targeting and intrachromosomal recombination (Elliott and Jasin, 2001). These reports suggest that the inhibition of MutS α and MutS β by CdCl2 treatment may increase HR efficiency. However, it has been reported that low-dose CdCl2 (1 μM) in Mac-T cells does not increase HR efficiency (Kim et al., 2022).

To address the conflicting reports, we aimed to determine the change in knock-in efficiency when MMR is suppressed through high-dose CdCl2 treatment (10 μM), an MMR inhibitor, in HC11 cells. Furthermore, to assess the mechanism of HR inhibition by CdCl2 treatment, we assessed the expression of MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV.

Construction of knock-in vector

The knock-in vector used in this study expresses hEPO protein using the GST fusion system at the mouse beta-casein Exon3 locus. The knock-in vector, which consists of a 5’ homology arm (1.024 kb), GST-PreScission protease-hEPO, SV40polyA, CMV-EGFP, and a 3’ homology arm (1.81 kb), was originally developed in our laboratory. The vector was modified in this study; CMV-EGFP, a positive selection marker, was replaced with PGK neo, a negative selection marker, and the 3’ homology arm of 1.81 kb was modified to a 3’ homology arm of 1.015 kb. As a result, the final knock-in vector was constructed as PBSK_1.024kb mBC5’arm_GST_hEPO_SV40polyA_PGK neo_1.015kb mBC3’arm.

Cell culture and transfection

Mouse mammary epithelial cells (HC11) were cultured in the growth medium consisting of Roswell Park Memorial Institute (RPMI) 1640 medium (Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone), 1% penicillin/streptomycin (Hyclone), 0.1% gentamicin (Sigma, St. Louis, MO, USA), 0.1% EGF (Gibco, Thermo Fisher, USA), and 0.05% insulin (Sigma). HC11 cells were seeded at a density of 2.4 × 105 cells per well into 6-well plates (SPL, Gyeonggi-do, Korea) and incubated at 37℃ with 5% CO2. The medium was replaced with 1 mL of fresh medium before transfection. The knock-in vector (3.75 μg) and pGuide it Zs Green1_sgRNA expression vector (1.875 μg) were transfected into HC11 cells using the Xfect transfection reagent (Takara, Tokyo, Japan). After 24 hours of transfection, the cells were treated with 10 μM CdCl2 and incubated for 48 hours.

Reverse transcription followed by quantitative polymerase chain reaction

Total RNA from HC11 cells was isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany). A total of 3 μg of RNA was used as a template for cDNA synthesis, which was performed using random hexamers and M-MLV reverse transcriptase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s protocol. Quantitative PCR was performed to measure the mRNA expression of DNA MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2), the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV in a total volume of 20 μL, containing 20 ng of cDNA, 10 pmole of forward and reverse primer pairs (Table 1), and 10 μL of TOPrealTM qPCR 2X PreMIX (Enzynomics, Daejeon, Korea). All qPCR experiments were performed in triplicate using the Mx3000p instrument (Agilent Technologies, Santa Clara, CA, USA) through the following steps: denaturation at 95℃ for 10 minutes, followed by 40 cycles of amplification at 95℃ for 10 seconds, annealing at 60℃ for 15 seconds, and strand extension at 72℃ for 15 seconds. For comparative quantification, the mRNA expression levels of each gene were normalized to that of the mouse Rplp0 transcript.

Table 1 . Primers used for GST_hEPO screening PCR analysis and quantitative PCR analysis of specific genes

GenePrimer nameSequence (5’ to 3’)
Primers used for GST_hEPO screening PCR analysis
Mouse β-casein 5’ armm C5 CV S5 βATAAGAACTGCAGTGGGATTCTTC
m C3 GST AS9 βAGCATTGAAATCTCTGCACGCTC
m C5 CV S6 βGTCTACCAATTCACTCTAGAAGTG
m C3 GST AS7 βACGTATGATGGCCATAGACTGTG
Primers used for quantitative real-time PCR analysis of MMR-related gene, Rad51, and DNA Ligase IV gene
Rplp0mRplp0 FCGACCTGGAAGTCCAACTA
mRplp0 RATCTGCTGCATCTGCTTG
MMR-related gene (Msh2, Msh3, Msh6, Mlh1, Pms2)mMsh2 CDS STGAAGTTGGACATGGCAGCA
mMsh2 CDS ASTAATGCGGCCAGAGACTGAG
mMsh3 CDS SCCATCGCCTATGCAACTCTA
mMsh3 CDS ASTCACAGACTGGTGGATAGTG
mMsh6 CDS SATACTCAGGCATGCAACAGC
mMsh6 CDS ASTCAAAAGTTGCGGTGCCTCT
mMlh1 CDS SAGATTAGTGAGCGGTGCCAT
mMlh1 CDS ASACTGAGGATTCACACAGCCC
mPms2 CDS SACTTCCAGGACGCCACAAAA
mPms2 CDS ASAACTGCCTGTCTGTTGCACT
HR-related gene Rad51Rad51 CDS SAATTCCGAACTGGGAAGACAC
Rad51 CDS ASTCACCTCCACCACGGTCAAT
NHEJ-related geneqPCR Ligase IV (CDS) STCCACAGGAAGGCTCTCTCA
DNA Ligase IVqPCR Ligase IV (CDS) ASTCTCACCGTCAAGGATGCAC


Western blot analysis

Nuclear and cytoplasmic proteins from HC11 cells were extracted using the NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Total protein from HC11 cells was extracted using the PRO-PREPTM protein extraction solution (iNtRON Biotechnology, Seoul, Korea) according to the manufacturer’s instructions. The nuclear and cytoplasmic protein extracts (15 μg) and total protein (30 μg) derived from the cells were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels and transferred to polyvinylidene fluoride membranes (Bio-Rad Co., Hercules, CA, USA). The membranes were then blocked for 2 hours at room temperature in 5% skim milk in TBST (Tris-buffered saline with 0.1% Tween 20), and blotted with a rabbit polyclonal anti-MSH2 antibody (ab-70270, Abcam, Cambridge, UK; dilution 1:2,000), mouse monoclonal anti-RAD51 (sc398587) and anti-DNA Ligase IV (sc271299, Santa Cruz Biotechnology, Dallas, TX, USA; dilution 1:1,000), or anti-β-actin (a5441, Sigma; dilution 1:10,000) overnight at 4℃. After overnight incubation, the membranes were washed with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (ab205718, Abcam; dilution 1:2,000), mouse immunoglobulin G (IgG) kappa binding protein (m-IgGk BP) conjugated to horseradish peroxidase (sc516102, Santa Cruz Biotechnology; dilution 1:1,000), or mouse IgG2a binding protein k (m-IgG2a BP) conjugated to horseradish peroxidase (sc542731, Santa Cruz Biotechnology; dilution 1:1,000) at room temperature for 2 hours. The membranes were washed with TBST. Msh2, Rad51, DNA Ligase IV, HDAC2, and β-actin protein bands were detected using the EZ-Western Lumi Pico Kit and EZ-Western Lumi Femto Kit (Dogen, Seoul, Korea). For comparative quantification of protein levels, Rad51, Msh2, and DNA Ligase IV protein bands were normalized to β-actin.

Analysis of knock-in efficiency by polymerase chain reaction

The knock-in efficiency of the hEPO knock-in vector in HC11 cells was confirmed through first and second PCR experiments. The genomic DNA isolated from cells in each group was used as a DNA template for PCR. The first PCR was performed using the mβC5 CV S5 primer for regions outside the 5’ arm and the mβC3 GST9 (Table 1) for the GST region using the amplification reagent SolgTM 2X Multiplex (Solgent, Daejeon, South Korea). The PCR consisted 25 cycles of amplification at 95℃ for 20 seconds, annealing at 62℃ for 40 seconds, and strand extension at 72℃ for 2 minutes. Subsequently, a nested PCR was performed using the mβC5 CV primer and the mβC3 GST AS7 primer using the amplification regent KOD FX Neo (Toyobo, Osaka, Japan) through the following steps: 25 cycles of denaturation at 95℃ for 20 seconds, annealing at 64℃ for 30 seconds, and strand extension at 72℃ for 2 minutes; followed by a final extension at 72℃ for 5 min. The PCR fragments were confirmed through electrophoresis on a 0.8% agarose gel. For comparative quantification, each DNA band was normalized to the mβCE7 region.

Statistical analysis

Densitometric quantification of DNA or protein bands was performed by analyzing the data using UN-SCAN-IT gel Analysis Software (Silk Scientific Inc., Orem, UT, USA). Subsequently, a statistical analysis of the mRNA levels and densitometric quantification of DNA and protein bands was performed using GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA, USA). The data were analyzed in two ways. First, the data were analyzed with one-way ANOVA, followed by the Dunnett test, to compare all columns with reference to the control column. Second, a t-test was performed to compare the differences between the two columns. The confidence interval was set at 95%.

Construction of the knock-in vector for hEPO gene expression in the mouse beta-casein locus

The diagram illustrating the knock-in vector used for expressing the human erythropoietin (hEPO) gene in the mouse β-casein locus is shown in Fig. 1. The knock-in vector consisted of the 5’-homology arm, GST-hEPO fused gene, SV40 poly A signal, PGK-Neo, and the 3’ homology arm. The Neo gene, lacking a polyA signal, was used as a positive selection marker. In this study, the knock-in vector functions as an hEPO expression vector that can be inserted into EXON 3 of the mouse beta-casein gene locus using the CRISPR/Cas9 system. If the knock-in vector is accurately introduced into the mouse beta-casein exon 3 locus through homologous recombination, the GST-hEPO gene can be expressed under the control of the gene regulatory sequence and promoter of the beta-casein, resulting in the production of the GST-hEPO protein. Additionally, because the GST-hEPO fusion protein contains a cleavage site for PreScission Protease, hEPO can be easily purified by removing the GST-tag.

Figure 1. The knock-in strategy at the mouse β-casein exon 3 locus for the expression of human erythropoietin. (A) Genome structure of the β-casein gene locus. (B) GST-hEPO knock-in vector I (Exon3). (C) Targeted locus of the knock-in vector by homologous recombination. The PCR primer pairs used for detecting HR events are indicated by arrows. PCR, polymerase chain reaction.

The mRNA and protein expression levels of DNA MMR-related genes, Rad51, and DNA Ligase IV in HC11 cells treated with CdCl2

To determine the effect of high-dose CdCl2 treatment (10 μM) on the mRNA expression of Rad51, DNA Ligase IV, and DNA MMR-related genes (Msh2, Msh3, Msh6, Mlh1, and Pms2), HC11 cells were treated with 10 μM CdCl2 for 2 days. As shown in Fig. 2A, the mRNA expression levels of Msh2, Msh6, and Pms2 decreased over time with cadmium treatment. Compared with the control group, the mRNA levels of Msh2 and Msh6 decreased by 84% and 74%, respectively, while Pms2 mRNA level decreased by 31%. In contrast, the expression of Msh3 mRNA rapidly increased on day 2 (5.4 fold; p < 0.01). However, Mlh1 mRNA expression remained unchanged after the high-dose CdCl2 treatment. As shown in Fig. 2B, the mRNA expression of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV tended to decrease with increasing duration of cadmium treatment, and at 48 h, the mRNA expression of Rad51 was about 80% (p < 0.001) compared to the cadmium-untreated control group, and DNA Ligase IV mRNA expression showed a significant decrease of about 76% (p < 0.001).

Figure 2. The mRNA expression of MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV in HC11 cells treated with CdCl2. (A) The mRNA levels of MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2). (B) The mRNA levels of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV. CdCl2 treatment was performed at a final concentration of 10 μM. Day 0 indicates HC11 cells not treated with CdCl2. CdCl2, cadmium chloride; NS, not statistically significant. *p < 0.05; **p < 0.01; ***p < 0.0001.

In order to determine the protein levels of Rad51, DNA Ligase IV, and MMR-related genes in HC11 cells treated with high-dose CdCl2, a western blot analysis was carried out, and the protein levels were normalized to that of beta-actin. As shown in Fig. 3A and 3B, the nuclear levels of Msh2 decreased by 18% (p < 0.01) at 24 h after high-dose CdCl2 treatment compared to the control group not exposed to cadmium. However, nuclear Msh2 levels did not decrease at 48 h. The NHEJ-related protein DNA Ligase IV (Lig4) did not exhibit any changes in the nucleus following high-dose CdCl2 treatment. The expression of HR-related Rad51 showed a significant decrease of about 40% (p < 0.05) at 48 h after cadmium treatment compared to the control group. It is known that the expression of HDAC2, a histone protein, decreases with cadmium treatment. We confirmed that the HDAC2 protein expression decreased with increasing duration of cadmium treatment. In addition, the cytoplasmic protein levels of Msh2 and Lig4 remained unchanged after high-dose CdCl2 treatment (Fig. 3A and 3C).

Figure 3. Protein expression of the MMR-related protein Msh2, the HR-related protein Rad51, and the NHEJ-related protein DNA Ligase IV (Lig4) in HC11 cells treated with CdCl2. (A) Nuclear and cytoplasmic protein levels of Msh2, Lig4, Rad51, and Hdac2 in HC11 cells treated with CdCl2 at a final concentration of 10 μM. (B) The graph represents the densitometric quantification of the protein bands. (C) The graph represents the densitometric quantification of the cytoplasm protein bands. Protein expression levels were normalized by calculating the target gene/β-actin ratio. HDAC, histone deacetylase; NS, not statistically significant. *p < 0.05; **p < 0.01.

The CRISPR/Cas9-mediated knock-in efficiency in HC11 cells treated with a high-dose of CdCl2

To investigate the efficiency of CRISPR-Cas9-mediated knock-in, HC11 cells were exposed to high-dose CdCl2 treatment and transfected with the GST-hEPO knock-in and the CRISPR-sgRNA expression vectors. The knock-in efficiency was analyzed after 48 h of CdCl2 treatment (Fig. 4). The CRISPR-Cas9-mediated knock-in efficiency in the HC11 cells treated with a high-dose of CdCl2 decreased by about 13% (p < 0.05) compared to the control group not treated with cadmium. Additionally, the mRNA expression levels of MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2), the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV were examined using RT-qPCR. The results indicated that the mRNA expression levels of the MMR-related genes Msh2, Msh6, Pms2, and Msh3, as well as those of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV, were comparable to their levels in the HC11 cells that did not undergo CRISPR-Cas9-mediated knock-in. However, the mRNA expression of Mlh1 decreased by 52% (p < 0.05) compared to the control group not treated with CdCl2 (Fig. 4).

Figure 4. The knock-in efficiency of gene targeting and mRNA expression of MMR-related, HR-related, and NHEJ-related genes in HC11 cells treated with CdCl2. (A) Agarose gel electrophoresis of knock-in DNA band and densitometric quantification of PCR results. CdCl2 treatment was performed at a final concentration of 10 μM. (B) The mRNA levels of MMR-related (Mlh1), HR-related (Rad51), and NHEJ-related (DNA Ligase IV) genes. CdCl2 treatment was performed at a final concentration of 10 μM. PCR, polymerase chain reaction; M, DNA size marker (1-kb ladder); PC, positive control. *p < 0.05; ***p < 0.0001.

This study investigated whether the HR efficiency at the mouse beta-casein locus using CRISPR/Cas9 system was associated with the regulation of DNA mismatch repair (MMR) through high-dose CdCl2 treatment in HC11 cells.

It has been reported that the efficiency of DSB-promoted recombination for divergence substrates is higher in Msh2-deficient cells compared to Msh2-proficient cells. In the same study, when intrachromosomal recombination is induced, MMR deficiency has been found to overcome the difficulty of divergence sequence recombination in DSB-promoted and spontaneous recombination (Elliot and Jasin, 2001). Yang et al. (2004) also reported an increase in RAD51 foci in human MSH2/MSH6-deficient cells. Based on these findings, we hypothesized that MMR deficiency could increase the efficiency of DSB-promoted HR recombination.

Therefore, to evaluate the expression of DNA MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV after treatment with CdCl2, an MMR inhibitor (Jin et al., 2003; Clark and Kunkel, 2004; Lützen et al., 2004; Banerjee and Flores-Rozas, 2005; Sherrer et al., 2018), HC11 cells were treated with 10 μM CdCl2 for 48 hours. As a result, the mRNA expression of Msh2, Msh6, and Pms2 decreased compared to the CdCl2-untreated group, but the mRNA expression of Mlh1 did not change. The result was similar to those reported by Clark and Kunkel in 2004, where CdCl2 has been found to inhibit the Msh2-Msh6 heterodimer in yeast without effecting the Mlh1-Pms1 heterodimer. These results were also similar to the findings of Sherrer et al. (2018) reporting that CdCl2 inhibits MutL alpha (Mlh1-Pms2 heterodimer), which acts as an endonuclease in the early stage of DNA MMR in eukaryotic cells.

Interestingly, the mRNA expression of the Msh3 gene in CdCl2-treated HC11 cells increased rapidly compared to the CdCl2-untreated group. Since Msh2 and Msh3 are known to act as heterodimers (Fishel and Wilson, 1997), we expected that the mRNA expression of Msh3 would also decrease. These results can be supported by the report that Msh3 and Msh2 are independently regulated according to the cellular response to DNA MMR (Selva et al., 1997), suggesting that the expression trends of Msh3 and Msh2 may differ. In addition, Marra et al. (1998) reported that overexpression of MSH3 causes an imbalance in the relative amounts of MSH3 and MSH6, reducing the expression of human MSH2/MSH6. It seems likely that the increased expression of Msh3 in this study is the result of an imbalance between DNA MMR-related genes. However, the rapid increase in Msh3 expression with CdCl2 treatment can be interpreted in several ways; therefore, additional studies are needed.

In this study, we analyzed the effects of high-dose CdCl2 treatment on the expression of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV in HC11 cells. Specifically, we expected that the expression of Rad51 would increase based on a previous research report by Yang et al. (2004) showing that Rad51 foci are increased in MSH2/MSH6 deficient cells. However, contrary to our expectations, Rad51 expression was decreased in HC11 cells, despite the decreases in Msh2 and Msh6 levels observed in this study. These results are consistent with findings from studies on zebrafish liver cells (Chen et al., 2014) and Japanese medaka (Barjhoux et al., 2016), which also showed that CdCl2 treatment reduces Rad51 expression. Another study by Lützen et al. (2004) reported that CdCl2 inhibits RPA, which has a multifunctional binding site to interact with Rad51. Additionally, mutation of the Rad51N binding site in RPA70A reduces the ability of Rad51 to replace RPA in ssDNA (Stauffer and Chazin, 2004). These findings suggest that CdCl2 treatment can reduce the expression of Rad51 by inhibiting RPA. The high-dose CdCl2 treatment in HC11 cells also reduced the mRNA expression of the NHEJ-related gene DNA Ligase IV compared to the non-CdCl2-treated control. This result is consistent with a report by Li et al. (2015), which showed that CdCl2 treatment reduces the expression of DNA Ligase IV in human cells.

In protein expression analysis, the nuclear levels of the Msh2 protein significantly decreased in HC11 cells treated with high-dose CdCl2 at 24 h; Msh2 levels slightly decreased at 48 h, but there was no significant difference. These results indicate that treatment with 10 μM CdCl2 does not completely inhibit the nuclear expression of Msh2. In addition, the nuclear levels of Rad51 significantly decreased at 48 h compared to non-CdCl2-treated group. Chidambaram et al. (2017) reported that CdCl2 treatment reduces histone deacetylase 2 (Hdac2) expression, and, in this study, the protein expression of Hdac2 decreased with increasing duration of CdCl2 treatment. There was no significant difference in the cytoplasmic protein levels of Msh2 and DNA Ligase IV (Lig4) compared to the CdCl2-untreated control group. The differences in the levels of Msh2, Rad51, and Lig4 in nuclear and cytoplasmic fractions are thought to be due to the fact that these proteins act mainly in the nucleus and are regulated by DNA repair pathways.

In this study, we performed CRISPR-Cas9-mediated gene targeting at the mouse beta-casein locus to determine the effect of high-dose CdCl2 treatment on HR efficiency in HC11 cells. The results showed that high-dose CdCl2 treatment slightly decreased the knock-in efficiency in HC11 cells compared to the CdCl2-untreated group. Additionally, we examined the mRNA expression of MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV during homologous recombination through high-dose CdCl2 treatment and CRISPR-Cas9-mediated gene targeting in HC11 cells. CdCl2 treatment led to a decrease in the mRNA expression of DNA MMR-related genes (Msh2, Msh6, Mlh1, Pms2) and an increase in Msh3 mRNA expression. Furthermore, the mRNA levels of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV were reduced compared to the CdCl2-untreated group. These results were consistent with the MMR-related gene expression in HC11 cells treated only with high-dose CdCl2 without CRISPR-Cas9-mediated gene targeting (Fig. 2). Interestingly, in HC11 cells, high-dose CdCl2 treatment and CRISPR-Cas9 mediated gene targeting significantly reduced Mlh1 mRNA expression. This suggests that these results may be attributed to the suppression of the MMR pathway initiator gene Msh2. A study by Kim et al. (2022) reported that low-dose CdCl2 treatment does not inhibit MMR-related genes when CRISPR/Cas9-mediated gene targeting is performed at the bovine beta-casein locus. Moreover, failure to suppress the expression of MMR-related genes has been reported as a potential cause of reduced knock-in efficiency.

In this study, high concentrations of cadmium were used to compensate for the problem of MMR-related gene inhibition. However, despite the suppression of MMR-related genes, the knock-in efficiency did not improve. Although it was believed that the inhibition of MMR-related gene expression through high-dose CdCl2 would improve the HR mechanism, this was not the case.

Therefore, the high-dose CdCl2 treatment can be used as a DNA MMR inhibitor that can suppress DNA MMR genes. However, it was deemed inappropriate as a method for improving the efficiency of HR due to the decrease in expression of the HR-related gene Rad51. In addition, further research is needed to determine whether the inhibition of MMR-related genes caused a decrease in Rad51 expression, or whether the high-dose CdCl2 treatment itself led to a decrease in Rad51.

This study aimed to determine the potential changes in the efficiency of CRISPR-Cas9-mediated knock-in induced by treatment with high-dose CdCl2, an MMR inhibitor. During homologous recombination, the expression of MMR-related genes was suppressed in HC11 cells treated with cadmium, and the mRNA and protein expression of the HR-related gene Rad51 was decreased. Consequently, the efficiency of HR did not increase in cadmium-treated DNA MMR-deficient cells. Therefore, it appears that cadmium treatment, which induces DNA MMR deficiency and reduces the expression of the HR-related gene Rad51, is not an appropriate compound for improving HR efficiency.

Conceptualization, G-Y.K. and M-J.K.; investigation, G-Y.K. and M-J.K.; data curation, G-Y.K. and M-J.K.; writingoriginal draft preparation, G-Y.K. and M-J.K.; writingreview and editing, G-Y.K. and M-J.K.; supervision, M-J.K.

This work was supported by a National Research Foundation of Korea (NRF) grant awarded by the Korea government (MSIT) (No.2021R1F1A1052105).

  1. Banerjee S and Flores-Rozas H. 2005. Cadmium inhibits mismatch repair by blocking the ATPase activity of the MSH2-MSH6 complex. Nucleic Acids Res. 33:1410-1419. (Erratum published 2005, Nucleic Acids Res. 33:1738).
    Pubmed KoreaMed CrossRef
  2. Barjhoux I, Gonzalez P, Cachot J. 2016. Molecular and phenotypic responses of Japanese medaka (Oryzias latipes) early life stages to environmental concentrations of cadmium in sediment. Environ. Sci. Pollut. Res. Int. 23:17969-17981.
    Pubmed CrossRef
  3. Chakraborty U and Alani E. 2016. Understanding how mismatch repair proteins participate in the repair/anti-recombination decision. FEMS Yeast Res. 16:fow071.
    Pubmed KoreaMed CrossRef
  4. Chen YY, Chan KM. 2014. Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells. Aquat. Toxicol. 157:196-206.
    Pubmed CrossRef
  5. Chidambaram A, Sekar A, S H K, Chidambaram RK, Arunachalam K, Vilwanathan R. 2017. Synthesis, characterization, and evaluation of Cd[L-proline]2, a novel histone deacetylase inhibitor that induces epigenetic modification of histone deacetylase isoforms in A549 cells. Invest. New Drugs 35:691-705.
    Pubmed CrossRef
  6. Clark AB and Kunkel TA. 2004. Cadmium inhibits the functions of eukaryotic MutS complexes. J. Biol. Chem. 279:53903-53906.
    Pubmed CrossRef
  7. Elliott B and Jasin M. 2001. Repair of double-strand breaks by homologous recombination in mismatch repair-defective mammalian cells. Mol. Cell. Biol. 21:2671-2682.
    Pubmed KoreaMed CrossRef
  8. Fishel R and Wilson T. 1997. MutS homologs in mammalian cells. Curr. Opin. Genet. Dev. 7:105-113.
    Pubmed CrossRef
  9. Goldfarb T and Alani E. 2005. Distinct roles for the Saccharomyces cerevisiae mismatch repair proteins in heteroduplex rejection, mismatch repair and nonhomologous tail removal. Genetics 169:563-574.
    Pubmed KoreaMed CrossRef
  10. Habraken Y, Sung P, Prakash S. 1996. Binding of insertion/deletion DNA mismatches by the heterodimer of yeast mismatch repair proteins MSH2 and MSH3. Curr. Biol. 6:1185-1187.
    Pubmed CrossRef
  11. Jayathilaka K, Sheridan SD, Bold TD, Bochenska K, Logan HL, Weichselbaum RR, Connell PP. 2008. A chemical compound that stimulates the human homologous recombination protein RAD51. Proc. Natl. Acad. Sci. U. S. A. 105:15848-15853.
    Pubmed KoreaMed CrossRef
  12. Jin YH, Clark AB, Slebos RJ, Al-Refai H, Taylor JA, Kunkel TA, Gordenin DA. 2003. Cadmium is a mutagen that acts by inhibiting mismatch repair. Nat. Genet. 34:326-329.
    Pubmed KoreaMed CrossRef
  13. Kim SY, Kim GY, Kang MJ. 2022. Relationship between DNA mismatch repair and CRISPR/Cas9-mediated knock-in in the bovine β-casein gene locus. Anim. Biosci. 35:126-137.
    Pubmed KoreaMed CrossRef
  14. Kunkel TA and Erie DA. 2015. Eukaryotic mismatch repair in relation to DNA replication. Annu. Rev. Genet. 49:291-313.
    Pubmed KoreaMed CrossRef
  15. Lahue RS, Modrich P. 1989. DNA mismatch correction in a defined system. Science 245:160-164.
    Pubmed CrossRef
  16. Li GM. 2008. Mechanisms and functions of DNA mismatch repair. Cell Res. 18:85-98.
    Pubmed CrossRef
  17. Li W, Gu X, Zhang X, Kong J, Ding N, Qi Y, Zhang Y, Huang D. 2015. Cadmium delays non-homologous end joining (NHEJ) repair via inhibition of DNA-PKcs phosphorylation and downregulation of XRCC4 and Ligase IV. Mutat. Res. 779:112-123.
    Pubmed CrossRef
  18. Long DT, Räschle M, Walter JC. 2011. Mechanism of RAD51-dependent DNA interstrand cross-link repair. Science 333:84-87.
    Pubmed KoreaMed CrossRef
  19. Lützen A, Rasmussen LJ. 2004. Cadmium inhibits human DNA mismatch repair in vivo. Biochem. Biophys. Res. Commun. 321:21-25.
    Pubmed CrossRef
  20. Mao Z, Bozzella M, Gorbunova V. 2008. DNA repair by nonhomologous end joining and homologous recombination during cell cycle in human cells. Cell Cycle 7:2902-2906.
    Pubmed KoreaMed CrossRef
  21. Marra G, Iaccarino I, Lettieri T, Roscilli G, Jiricny J. 1998. Mismatch repair deficiency associated with overexpression of the MSH3 gene. Proc. Natl. Acad. Sci. U. S. A. 95:8568-8573.
    Pubmed KoreaMed CrossRef
  22. Maruyama T, Dougan SK, Truttmann MC, Bilate AM, Ploegh HL. 2015. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat. Biotechnol. 33:538-542. (Erratum published 2016, Nat. Biotechnol. 34:210).
    Pubmed KoreaMed CrossRef
  23. Ochi T, Wu Q, Chirgadze DY, Grossmann JG, Blundell TL. 2012. Structural insights into the role of domain flexibility in human DNA ligase IV. Structure 20:1212-1222.
    Pubmed KoreaMed CrossRef
  24. Selva EM, Lahue RS. 1997. Differential effects of the mismatch repair genes MSH2 and MSH3 on homeologous recombination in Saccharomyces cerevisiae. Mol. Gen. Genet. 257:71-82.
    Pubmed CrossRef
  25. Sherrer SM, Modrich P. 2018. The mutagen and carcinogen cadmium is a high-affinity inhibitor of the zinc-dependent MutLα endonuclease. Proc. Natl. Acad. Sci. U. S. A. 115:7314-7319.
    Pubmed KoreaMed CrossRef
  26. Song J, Yang D, Xu J, Zhu T, Zhang J. 2016. RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency. Nat. Commun. 7:10548.
    Pubmed KoreaMed CrossRef
  27. Spies M and Fishel R. 2015. Mismatch repair during homologous and homeologous recombination. Cold Spring Harb. Perspect. Biol. 7:a022657.
    Pubmed KoreaMed CrossRef
  28. Stauffer ME and Chazin WJ. 2004. Physical interaction between replication protein A and Rad51 promotes exchange on single-stranded DNA. J. Biol. Chem. 279:25638-25645.
    Pubmed CrossRef
  29. Vasquez KM, Marburger K, Wilson JH. 2001. Manipulating the mammalian genome by homologous recombination. Proc. Natl. Acad. Sci. U. S. A. 98:8403-8410.
    Pubmed KoreaMed CrossRef
  30. Yang Q, Zhang R, Wang XW, Linke SP, Sengupta S, Hickson ID, Pedrazzi G, Perrera C, Stagljar I, Littman SJ, Harris CC. 2004. The mismatch DNA repair heterodimer, hMSH2/6, regulates BLM helicase. Oncogene 23:3749-3756.
    Pubmed CrossRef

Article

Original Article

Journal of Animal Reproduction and Biotechnology 2023; 38(3): 99-108

Published online September 30, 2023 https://doi.org/10.12750/JARB.38.3.99

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Cadmium chloride down-regulates the expression of Rad51 in HC11 cells and reduces knock-in efficiency

Ga-Yeon Kim and Man-Jong Kang*

Department of Animal Science, College of Agriculture and Life Science, Chonnam National University, Gwangju 61186, Korea

Correspondence to:Man-Jong Kang
E-mail: mjkang@jnu.ac.kr

Received: August 9, 2023; Revised: August 16, 2023; Accepted: August 16, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background: Efficient gene editing technology is needed for successful knock-in. Homologous recombination (HR) is a major double-strand break repair pathway that can be utilized for accurately inserting foreign genes into the genome. HR occurs during the S/G2 phase, and the DNA mismatch repair (MMR) pathway is inextricably linked to HR to maintain HR fidelity. This study was conducted to investigate the effect of inhibiting MMR-related genes using CdCl2, an MMR-related gene inhibitor, on HR efficiency in HC11 cells.
Methods: The mRNA and protein expression levels of MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2), the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV were assessed in HC11 cells treated with 10 μM of CdCl2 for 48 hours. In addition, HC11 cells were transfected with a CRISPR/sgRNA expression vector and a knock-in vector targeting Exon3 of the mouse-beta casein locus, and treated with 10 μM cadmium for 48 hours. The knock-in efficiency was monitored through PCR.
Results: The treatment of HC11 cells with a high-dose of CdCl2 decreased the mRNA expression of the HR-related gene Rad51 in HC11 cells. In addition, the inhibition of MMR-related genes through CdCl2 treatment did not lead to an increase in knock-in efficiency.
Conclusions: The inhibition of MMR-related gene expression through high-dose CdCl2 treatment reduces the expression of the HR-related gene Rad51, which is active during recombination. Therefore, it was determined that CdCl2 is an inappropriate compound for improving HR efficiency.

Keywords: cadmium chloride, CRISPR-Cas9 mediated knock-in efficiency, DNA mismatch repair, homologous recombination, non-homologous end joining

INTRODUCTION

Gene targeting is a useful technique for inserting foreign genes into a specific locus in the genome. The major pathways of double-strand break (DSB) repair are homologous recombination (HR) and non-homologous end joining (NHEJ). The HR pathway is utilized to accurately insert foreign genes into the genome, but it occurs only during the S/G2 phase, and its efficiency for DSB repair is lower than that of NHEJ (Vasquez et al., 2001; Mao et al., 2008). Thus, studies have been performed to improve the efficiency of HR for accurate gene targeting. The HR-related gene Rad51 is involved in strand invasion and mediates homologous DNA pairing (Long et al., 2011). The NHEJ-related gene DNA Ligase IV is crucial for ligating DNA ends resulting from DSBs in the NHEJ pathway (Ochi et al., 2012). SCR7, an inhibitor of the NHEJ-related gene DNA Ligase IV, has been reported to increase HR efficiency in mammalian cells by up to 19-fold (Maruyama et al., 2015). RS-1 is a chemical compound that stimulates Rad51 (Jayathilaka et al., 2008) and has been shown to increase knock-in efficiency in rabbit embryos by 25-fold (Song et al., 2016). However, the efficiency of gene targeting varies depending on the species or cell type, and further studies are needed for accurate gene targeting. Therefore, it is essential to examine DNA repair pathways closely related to the HR pathway.

The DNA mismatch repair (MMR) is known to be inextricably linked to HR (Spies and Fishel, 2015), and is reported as a post-replication repair pathway that occurs during replication or recombination (Li, 2008). The MMR-related MutS α (MSH2-MSH6) and MutS β (MSH2-MSH3) proteins bind to a mismatched DNA base pair, and MutL α (MLH1-PMS2) is an endonuclease that binds to MutS-heteroduplex complexes (Lahue et al., 1989; Habraken et al., 1996). The MMR maintains HR fidelity and prevents recombination between divergent sequences through heteroduplex rejection in the presence of extensive heteroduplexes during the recombination process (Goldfarb and Alani, 2005; Kunkel and Erie, 2015; Chakaraborty and Alani, 2016).

CdCl2 treatment inhibits ATP hydrolysis of MutS α (MSH2-MSH6) in eukaryotic cells and specific binding to mismatched DNA (Clark and Kunkel, 2004). Meanwhile, it has been reported that knock-out of Msh2 accelerates the DSB-promoted recombination by divergence substrates in gene targeting and intrachromosomal recombination (Elliott and Jasin, 2001). These reports suggest that the inhibition of MutS α and MutS β by CdCl2 treatment may increase HR efficiency. However, it has been reported that low-dose CdCl2 (1 μM) in Mac-T cells does not increase HR efficiency (Kim et al., 2022).

To address the conflicting reports, we aimed to determine the change in knock-in efficiency when MMR is suppressed through high-dose CdCl2 treatment (10 μM), an MMR inhibitor, in HC11 cells. Furthermore, to assess the mechanism of HR inhibition by CdCl2 treatment, we assessed the expression of MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV.

MATERIALS AND METHODS

Construction of knock-in vector

The knock-in vector used in this study expresses hEPO protein using the GST fusion system at the mouse beta-casein Exon3 locus. The knock-in vector, which consists of a 5’ homology arm (1.024 kb), GST-PreScission protease-hEPO, SV40polyA, CMV-EGFP, and a 3’ homology arm (1.81 kb), was originally developed in our laboratory. The vector was modified in this study; CMV-EGFP, a positive selection marker, was replaced with PGK neo, a negative selection marker, and the 3’ homology arm of 1.81 kb was modified to a 3’ homology arm of 1.015 kb. As a result, the final knock-in vector was constructed as PBSK_1.024kb mBC5’arm_GST_hEPO_SV40polyA_PGK neo_1.015kb mBC3’arm.

Cell culture and transfection

Mouse mammary epithelial cells (HC11) were cultured in the growth medium consisting of Roswell Park Memorial Institute (RPMI) 1640 medium (Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone), 1% penicillin/streptomycin (Hyclone), 0.1% gentamicin (Sigma, St. Louis, MO, USA), 0.1% EGF (Gibco, Thermo Fisher, USA), and 0.05% insulin (Sigma). HC11 cells were seeded at a density of 2.4 × 105 cells per well into 6-well plates (SPL, Gyeonggi-do, Korea) and incubated at 37℃ with 5% CO2. The medium was replaced with 1 mL of fresh medium before transfection. The knock-in vector (3.75 μg) and pGuide it Zs Green1_sgRNA expression vector (1.875 μg) were transfected into HC11 cells using the Xfect transfection reagent (Takara, Tokyo, Japan). After 24 hours of transfection, the cells were treated with 10 μM CdCl2 and incubated for 48 hours.

Reverse transcription followed by quantitative polymerase chain reaction

Total RNA from HC11 cells was isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany). A total of 3 μg of RNA was used as a template for cDNA synthesis, which was performed using random hexamers and M-MLV reverse transcriptase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s protocol. Quantitative PCR was performed to measure the mRNA expression of DNA MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2), the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV in a total volume of 20 μL, containing 20 ng of cDNA, 10 pmole of forward and reverse primer pairs (Table 1), and 10 μL of TOPrealTM qPCR 2X PreMIX (Enzynomics, Daejeon, Korea). All qPCR experiments were performed in triplicate using the Mx3000p instrument (Agilent Technologies, Santa Clara, CA, USA) through the following steps: denaturation at 95℃ for 10 minutes, followed by 40 cycles of amplification at 95℃ for 10 seconds, annealing at 60℃ for 15 seconds, and strand extension at 72℃ for 15 seconds. For comparative quantification, the mRNA expression levels of each gene were normalized to that of the mouse Rplp0 transcript.

Table 1. Primers used for GST_hEPO screening PCR analysis and quantitative PCR analysis of specific genes.

GenePrimer nameSequence (5’ to 3’)
Primers used for GST_hEPO screening PCR analysis
Mouse β-casein 5’ armm C5 CV S5 βATAAGAACTGCAGTGGGATTCTTC
m C3 GST AS9 βAGCATTGAAATCTCTGCACGCTC
m C5 CV S6 βGTCTACCAATTCACTCTAGAAGTG
m C3 GST AS7 βACGTATGATGGCCATAGACTGTG
Primers used for quantitative real-time PCR analysis of MMR-related gene, Rad51, and DNA Ligase IV gene
Rplp0mRplp0 FCGACCTGGAAGTCCAACTA
mRplp0 RATCTGCTGCATCTGCTTG
MMR-related gene (Msh2, Msh3, Msh6, Mlh1, Pms2)mMsh2 CDS STGAAGTTGGACATGGCAGCA
mMsh2 CDS ASTAATGCGGCCAGAGACTGAG
mMsh3 CDS SCCATCGCCTATGCAACTCTA
mMsh3 CDS ASTCACAGACTGGTGGATAGTG
mMsh6 CDS SATACTCAGGCATGCAACAGC
mMsh6 CDS ASTCAAAAGTTGCGGTGCCTCT
mMlh1 CDS SAGATTAGTGAGCGGTGCCAT
mMlh1 CDS ASACTGAGGATTCACACAGCCC
mPms2 CDS SACTTCCAGGACGCCACAAAA
mPms2 CDS ASAACTGCCTGTCTGTTGCACT
HR-related gene Rad51Rad51 CDS SAATTCCGAACTGGGAAGACAC
Rad51 CDS ASTCACCTCCACCACGGTCAAT
NHEJ-related geneqPCR Ligase IV (CDS) STCCACAGGAAGGCTCTCTCA
DNA Ligase IVqPCR Ligase IV (CDS) ASTCTCACCGTCAAGGATGCAC


Western blot analysis

Nuclear and cytoplasmic proteins from HC11 cells were extracted using the NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Total protein from HC11 cells was extracted using the PRO-PREPTM protein extraction solution (iNtRON Biotechnology, Seoul, Korea) according to the manufacturer’s instructions. The nuclear and cytoplasmic protein extracts (15 μg) and total protein (30 μg) derived from the cells were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels and transferred to polyvinylidene fluoride membranes (Bio-Rad Co., Hercules, CA, USA). The membranes were then blocked for 2 hours at room temperature in 5% skim milk in TBST (Tris-buffered saline with 0.1% Tween 20), and blotted with a rabbit polyclonal anti-MSH2 antibody (ab-70270, Abcam, Cambridge, UK; dilution 1:2,000), mouse monoclonal anti-RAD51 (sc398587) and anti-DNA Ligase IV (sc271299, Santa Cruz Biotechnology, Dallas, TX, USA; dilution 1:1,000), or anti-β-actin (a5441, Sigma; dilution 1:10,000) overnight at 4℃. After overnight incubation, the membranes were washed with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (ab205718, Abcam; dilution 1:2,000), mouse immunoglobulin G (IgG) kappa binding protein (m-IgGk BP) conjugated to horseradish peroxidase (sc516102, Santa Cruz Biotechnology; dilution 1:1,000), or mouse IgG2a binding protein k (m-IgG2a BP) conjugated to horseradish peroxidase (sc542731, Santa Cruz Biotechnology; dilution 1:1,000) at room temperature for 2 hours. The membranes were washed with TBST. Msh2, Rad51, DNA Ligase IV, HDAC2, and β-actin protein bands were detected using the EZ-Western Lumi Pico Kit and EZ-Western Lumi Femto Kit (Dogen, Seoul, Korea). For comparative quantification of protein levels, Rad51, Msh2, and DNA Ligase IV protein bands were normalized to β-actin.

Analysis of knock-in efficiency by polymerase chain reaction

The knock-in efficiency of the hEPO knock-in vector in HC11 cells was confirmed through first and second PCR experiments. The genomic DNA isolated from cells in each group was used as a DNA template for PCR. The first PCR was performed using the mβC5 CV S5 primer for regions outside the 5’ arm and the mβC3 GST9 (Table 1) for the GST region using the amplification reagent SolgTM 2X Multiplex (Solgent, Daejeon, South Korea). The PCR consisted 25 cycles of amplification at 95℃ for 20 seconds, annealing at 62℃ for 40 seconds, and strand extension at 72℃ for 2 minutes. Subsequently, a nested PCR was performed using the mβC5 CV primer and the mβC3 GST AS7 primer using the amplification regent KOD FX Neo (Toyobo, Osaka, Japan) through the following steps: 25 cycles of denaturation at 95℃ for 20 seconds, annealing at 64℃ for 30 seconds, and strand extension at 72℃ for 2 minutes; followed by a final extension at 72℃ for 5 min. The PCR fragments were confirmed through electrophoresis on a 0.8% agarose gel. For comparative quantification, each DNA band was normalized to the mβCE7 region.

Statistical analysis

Densitometric quantification of DNA or protein bands was performed by analyzing the data using UN-SCAN-IT gel Analysis Software (Silk Scientific Inc., Orem, UT, USA). Subsequently, a statistical analysis of the mRNA levels and densitometric quantification of DNA and protein bands was performed using GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA, USA). The data were analyzed in two ways. First, the data were analyzed with one-way ANOVA, followed by the Dunnett test, to compare all columns with reference to the control column. Second, a t-test was performed to compare the differences between the two columns. The confidence interval was set at 95%.

RESULTS

Construction of the knock-in vector for hEPO gene expression in the mouse beta-casein locus

The diagram illustrating the knock-in vector used for expressing the human erythropoietin (hEPO) gene in the mouse β-casein locus is shown in Fig. 1. The knock-in vector consisted of the 5’-homology arm, GST-hEPO fused gene, SV40 poly A signal, PGK-Neo, and the 3’ homology arm. The Neo gene, lacking a polyA signal, was used as a positive selection marker. In this study, the knock-in vector functions as an hEPO expression vector that can be inserted into EXON 3 of the mouse beta-casein gene locus using the CRISPR/Cas9 system. If the knock-in vector is accurately introduced into the mouse beta-casein exon 3 locus through homologous recombination, the GST-hEPO gene can be expressed under the control of the gene regulatory sequence and promoter of the beta-casein, resulting in the production of the GST-hEPO protein. Additionally, because the GST-hEPO fusion protein contains a cleavage site for PreScission Protease, hEPO can be easily purified by removing the GST-tag.

Figure 1.The knock-in strategy at the mouse β-casein exon 3 locus for the expression of human erythropoietin. (A) Genome structure of the β-casein gene locus. (B) GST-hEPO knock-in vector I (Exon3). (C) Targeted locus of the knock-in vector by homologous recombination. The PCR primer pairs used for detecting HR events are indicated by arrows. PCR, polymerase chain reaction.

The mRNA and protein expression levels of DNA MMR-related genes, Rad51, and DNA Ligase IV in HC11 cells treated with CdCl2

To determine the effect of high-dose CdCl2 treatment (10 μM) on the mRNA expression of Rad51, DNA Ligase IV, and DNA MMR-related genes (Msh2, Msh3, Msh6, Mlh1, and Pms2), HC11 cells were treated with 10 μM CdCl2 for 2 days. As shown in Fig. 2A, the mRNA expression levels of Msh2, Msh6, and Pms2 decreased over time with cadmium treatment. Compared with the control group, the mRNA levels of Msh2 and Msh6 decreased by 84% and 74%, respectively, while Pms2 mRNA level decreased by 31%. In contrast, the expression of Msh3 mRNA rapidly increased on day 2 (5.4 fold; p < 0.01). However, Mlh1 mRNA expression remained unchanged after the high-dose CdCl2 treatment. As shown in Fig. 2B, the mRNA expression of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV tended to decrease with increasing duration of cadmium treatment, and at 48 h, the mRNA expression of Rad51 was about 80% (p < 0.001) compared to the cadmium-untreated control group, and DNA Ligase IV mRNA expression showed a significant decrease of about 76% (p < 0.001).

Figure 2.The mRNA expression of MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV in HC11 cells treated with CdCl2. (A) The mRNA levels of MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2). (B) The mRNA levels of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV. CdCl2 treatment was performed at a final concentration of 10 μM. Day 0 indicates HC11 cells not treated with CdCl2. CdCl2, cadmium chloride; NS, not statistically significant. *p < 0.05; **p < 0.01; ***p < 0.0001.

In order to determine the protein levels of Rad51, DNA Ligase IV, and MMR-related genes in HC11 cells treated with high-dose CdCl2, a western blot analysis was carried out, and the protein levels were normalized to that of beta-actin. As shown in Fig. 3A and 3B, the nuclear levels of Msh2 decreased by 18% (p < 0.01) at 24 h after high-dose CdCl2 treatment compared to the control group not exposed to cadmium. However, nuclear Msh2 levels did not decrease at 48 h. The NHEJ-related protein DNA Ligase IV (Lig4) did not exhibit any changes in the nucleus following high-dose CdCl2 treatment. The expression of HR-related Rad51 showed a significant decrease of about 40% (p < 0.05) at 48 h after cadmium treatment compared to the control group. It is known that the expression of HDAC2, a histone protein, decreases with cadmium treatment. We confirmed that the HDAC2 protein expression decreased with increasing duration of cadmium treatment. In addition, the cytoplasmic protein levels of Msh2 and Lig4 remained unchanged after high-dose CdCl2 treatment (Fig. 3A and 3C).

Figure 3.Protein expression of the MMR-related protein Msh2, the HR-related protein Rad51, and the NHEJ-related protein DNA Ligase IV (Lig4) in HC11 cells treated with CdCl2. (A) Nuclear and cytoplasmic protein levels of Msh2, Lig4, Rad51, and Hdac2 in HC11 cells treated with CdCl2 at a final concentration of 10 μM. (B) The graph represents the densitometric quantification of the protein bands. (C) The graph represents the densitometric quantification of the cytoplasm protein bands. Protein expression levels were normalized by calculating the target gene/β-actin ratio. HDAC, histone deacetylase; NS, not statistically significant. *p < 0.05; **p < 0.01.

The CRISPR/Cas9-mediated knock-in efficiency in HC11 cells treated with a high-dose of CdCl2

To investigate the efficiency of CRISPR-Cas9-mediated knock-in, HC11 cells were exposed to high-dose CdCl2 treatment and transfected with the GST-hEPO knock-in and the CRISPR-sgRNA expression vectors. The knock-in efficiency was analyzed after 48 h of CdCl2 treatment (Fig. 4). The CRISPR-Cas9-mediated knock-in efficiency in the HC11 cells treated with a high-dose of CdCl2 decreased by about 13% (p < 0.05) compared to the control group not treated with cadmium. Additionally, the mRNA expression levels of MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2), the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV were examined using RT-qPCR. The results indicated that the mRNA expression levels of the MMR-related genes Msh2, Msh6, Pms2, and Msh3, as well as those of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV, were comparable to their levels in the HC11 cells that did not undergo CRISPR-Cas9-mediated knock-in. However, the mRNA expression of Mlh1 decreased by 52% (p < 0.05) compared to the control group not treated with CdCl2 (Fig. 4).

Figure 4.The knock-in efficiency of gene targeting and mRNA expression of MMR-related, HR-related, and NHEJ-related genes in HC11 cells treated with CdCl2. (A) Agarose gel electrophoresis of knock-in DNA band and densitometric quantification of PCR results. CdCl2 treatment was performed at a final concentration of 10 μM. (B) The mRNA levels of MMR-related (Mlh1), HR-related (Rad51), and NHEJ-related (DNA Ligase IV) genes. CdCl2 treatment was performed at a final concentration of 10 μM. PCR, polymerase chain reaction; M, DNA size marker (1-kb ladder); PC, positive control. *p < 0.05; ***p < 0.0001.

DISCUSSION

This study investigated whether the HR efficiency at the mouse beta-casein locus using CRISPR/Cas9 system was associated with the regulation of DNA mismatch repair (MMR) through high-dose CdCl2 treatment in HC11 cells.

It has been reported that the efficiency of DSB-promoted recombination for divergence substrates is higher in Msh2-deficient cells compared to Msh2-proficient cells. In the same study, when intrachromosomal recombination is induced, MMR deficiency has been found to overcome the difficulty of divergence sequence recombination in DSB-promoted and spontaneous recombination (Elliot and Jasin, 2001). Yang et al. (2004) also reported an increase in RAD51 foci in human MSH2/MSH6-deficient cells. Based on these findings, we hypothesized that MMR deficiency could increase the efficiency of DSB-promoted HR recombination.

Therefore, to evaluate the expression of DNA MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV after treatment with CdCl2, an MMR inhibitor (Jin et al., 2003; Clark and Kunkel, 2004; Lützen et al., 2004; Banerjee and Flores-Rozas, 2005; Sherrer et al., 2018), HC11 cells were treated with 10 μM CdCl2 for 48 hours. As a result, the mRNA expression of Msh2, Msh6, and Pms2 decreased compared to the CdCl2-untreated group, but the mRNA expression of Mlh1 did not change. The result was similar to those reported by Clark and Kunkel in 2004, where CdCl2 has been found to inhibit the Msh2-Msh6 heterodimer in yeast without effecting the Mlh1-Pms1 heterodimer. These results were also similar to the findings of Sherrer et al. (2018) reporting that CdCl2 inhibits MutL alpha (Mlh1-Pms2 heterodimer), which acts as an endonuclease in the early stage of DNA MMR in eukaryotic cells.

Interestingly, the mRNA expression of the Msh3 gene in CdCl2-treated HC11 cells increased rapidly compared to the CdCl2-untreated group. Since Msh2 and Msh3 are known to act as heterodimers (Fishel and Wilson, 1997), we expected that the mRNA expression of Msh3 would also decrease. These results can be supported by the report that Msh3 and Msh2 are independently regulated according to the cellular response to DNA MMR (Selva et al., 1997), suggesting that the expression trends of Msh3 and Msh2 may differ. In addition, Marra et al. (1998) reported that overexpression of MSH3 causes an imbalance in the relative amounts of MSH3 and MSH6, reducing the expression of human MSH2/MSH6. It seems likely that the increased expression of Msh3 in this study is the result of an imbalance between DNA MMR-related genes. However, the rapid increase in Msh3 expression with CdCl2 treatment can be interpreted in several ways; therefore, additional studies are needed.

In this study, we analyzed the effects of high-dose CdCl2 treatment on the expression of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV in HC11 cells. Specifically, we expected that the expression of Rad51 would increase based on a previous research report by Yang et al. (2004) showing that Rad51 foci are increased in MSH2/MSH6 deficient cells. However, contrary to our expectations, Rad51 expression was decreased in HC11 cells, despite the decreases in Msh2 and Msh6 levels observed in this study. These results are consistent with findings from studies on zebrafish liver cells (Chen et al., 2014) and Japanese medaka (Barjhoux et al., 2016), which also showed that CdCl2 treatment reduces Rad51 expression. Another study by Lützen et al. (2004) reported that CdCl2 inhibits RPA, which has a multifunctional binding site to interact with Rad51. Additionally, mutation of the Rad51N binding site in RPA70A reduces the ability of Rad51 to replace RPA in ssDNA (Stauffer and Chazin, 2004). These findings suggest that CdCl2 treatment can reduce the expression of Rad51 by inhibiting RPA. The high-dose CdCl2 treatment in HC11 cells also reduced the mRNA expression of the NHEJ-related gene DNA Ligase IV compared to the non-CdCl2-treated control. This result is consistent with a report by Li et al. (2015), which showed that CdCl2 treatment reduces the expression of DNA Ligase IV in human cells.

In protein expression analysis, the nuclear levels of the Msh2 protein significantly decreased in HC11 cells treated with high-dose CdCl2 at 24 h; Msh2 levels slightly decreased at 48 h, but there was no significant difference. These results indicate that treatment with 10 μM CdCl2 does not completely inhibit the nuclear expression of Msh2. In addition, the nuclear levels of Rad51 significantly decreased at 48 h compared to non-CdCl2-treated group. Chidambaram et al. (2017) reported that CdCl2 treatment reduces histone deacetylase 2 (Hdac2) expression, and, in this study, the protein expression of Hdac2 decreased with increasing duration of CdCl2 treatment. There was no significant difference in the cytoplasmic protein levels of Msh2 and DNA Ligase IV (Lig4) compared to the CdCl2-untreated control group. The differences in the levels of Msh2, Rad51, and Lig4 in nuclear and cytoplasmic fractions are thought to be due to the fact that these proteins act mainly in the nucleus and are regulated by DNA repair pathways.

In this study, we performed CRISPR-Cas9-mediated gene targeting at the mouse beta-casein locus to determine the effect of high-dose CdCl2 treatment on HR efficiency in HC11 cells. The results showed that high-dose CdCl2 treatment slightly decreased the knock-in efficiency in HC11 cells compared to the CdCl2-untreated group. Additionally, we examined the mRNA expression of MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV during homologous recombination through high-dose CdCl2 treatment and CRISPR-Cas9-mediated gene targeting in HC11 cells. CdCl2 treatment led to a decrease in the mRNA expression of DNA MMR-related genes (Msh2, Msh6, Mlh1, Pms2) and an increase in Msh3 mRNA expression. Furthermore, the mRNA levels of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV were reduced compared to the CdCl2-untreated group. These results were consistent with the MMR-related gene expression in HC11 cells treated only with high-dose CdCl2 without CRISPR-Cas9-mediated gene targeting (Fig. 2). Interestingly, in HC11 cells, high-dose CdCl2 treatment and CRISPR-Cas9 mediated gene targeting significantly reduced Mlh1 mRNA expression. This suggests that these results may be attributed to the suppression of the MMR pathway initiator gene Msh2. A study by Kim et al. (2022) reported that low-dose CdCl2 treatment does not inhibit MMR-related genes when CRISPR/Cas9-mediated gene targeting is performed at the bovine beta-casein locus. Moreover, failure to suppress the expression of MMR-related genes has been reported as a potential cause of reduced knock-in efficiency.

In this study, high concentrations of cadmium were used to compensate for the problem of MMR-related gene inhibition. However, despite the suppression of MMR-related genes, the knock-in efficiency did not improve. Although it was believed that the inhibition of MMR-related gene expression through high-dose CdCl2 would improve the HR mechanism, this was not the case.

Therefore, the high-dose CdCl2 treatment can be used as a DNA MMR inhibitor that can suppress DNA MMR genes. However, it was deemed inappropriate as a method for improving the efficiency of HR due to the decrease in expression of the HR-related gene Rad51. In addition, further research is needed to determine whether the inhibition of MMR-related genes caused a decrease in Rad51 expression, or whether the high-dose CdCl2 treatment itself led to a decrease in Rad51.

CONCLUSION

This study aimed to determine the potential changes in the efficiency of CRISPR-Cas9-mediated knock-in induced by treatment with high-dose CdCl2, an MMR inhibitor. During homologous recombination, the expression of MMR-related genes was suppressed in HC11 cells treated with cadmium, and the mRNA and protein expression of the HR-related gene Rad51 was decreased. Consequently, the efficiency of HR did not increase in cadmium-treated DNA MMR-deficient cells. Therefore, it appears that cadmium treatment, which induces DNA MMR deficiency and reduces the expression of the HR-related gene Rad51, is not an appropriate compound for improving HR efficiency.

Acknowledgements

None.

Author Contributions

Conceptualization, G-Y.K. and M-J.K.; investigation, G-Y.K. and M-J.K.; data curation, G-Y.K. and M-J.K.; writingoriginal draft preparation, G-Y.K. and M-J.K.; writingreview and editing, G-Y.K. and M-J.K.; supervision, M-J.K.

Funding

This work was supported by a National Research Foundation of Korea (NRF) grant awarded by the Korea government (MSIT) (No.2021R1F1A1052105).

Ethical Approval

Not applicable.

Consent to Participate

Not applicable.

Consent to Publish

Not applicable.

Availability of Data and Materials

Not applicable.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.The knock-in strategy at the mouse β-casein exon 3 locus for the expression of human erythropoietin. (A) Genome structure of the β-casein gene locus. (B) GST-hEPO knock-in vector I (Exon3). (C) Targeted locus of the knock-in vector by homologous recombination. The PCR primer pairs used for detecting HR events are indicated by arrows. PCR, polymerase chain reaction.
Journal of Animal Reproduction and Biotechnology 2023; 38: 99-108https://doi.org/10.12750/JARB.38.3.99

Fig 2.

Figure 2.The mRNA expression of MMR-related genes, the HR-related gene Rad51, and the NHEJ-related gene DNA Ligase IV in HC11 cells treated with CdCl2. (A) The mRNA levels of MMR-related genes (Msh2, Msh3, Msh6, Mlh1, Pms2). (B) The mRNA levels of the HR-related gene Rad51 and the NHEJ-related gene DNA Ligase IV. CdCl2 treatment was performed at a final concentration of 10 μM. Day 0 indicates HC11 cells not treated with CdCl2. CdCl2, cadmium chloride; NS, not statistically significant. *p < 0.05; **p < 0.01; ***p < 0.0001.
Journal of Animal Reproduction and Biotechnology 2023; 38: 99-108https://doi.org/10.12750/JARB.38.3.99

Fig 3.

Figure 3.Protein expression of the MMR-related protein Msh2, the HR-related protein Rad51, and the NHEJ-related protein DNA Ligase IV (Lig4) in HC11 cells treated with CdCl2. (A) Nuclear and cytoplasmic protein levels of Msh2, Lig4, Rad51, and Hdac2 in HC11 cells treated with CdCl2 at a final concentration of 10 μM. (B) The graph represents the densitometric quantification of the protein bands. (C) The graph represents the densitometric quantification of the cytoplasm protein bands. Protein expression levels were normalized by calculating the target gene/β-actin ratio. HDAC, histone deacetylase; NS, not statistically significant. *p < 0.05; **p < 0.01.
Journal of Animal Reproduction and Biotechnology 2023; 38: 99-108https://doi.org/10.12750/JARB.38.3.99

Fig 4.

Figure 4.The knock-in efficiency of gene targeting and mRNA expression of MMR-related, HR-related, and NHEJ-related genes in HC11 cells treated with CdCl2. (A) Agarose gel electrophoresis of knock-in DNA band and densitometric quantification of PCR results. CdCl2 treatment was performed at a final concentration of 10 μM. (B) The mRNA levels of MMR-related (Mlh1), HR-related (Rad51), and NHEJ-related (DNA Ligase IV) genes. CdCl2 treatment was performed at a final concentration of 10 μM. PCR, polymerase chain reaction; M, DNA size marker (1-kb ladder); PC, positive control. *p < 0.05; ***p < 0.0001.
Journal of Animal Reproduction and Biotechnology 2023; 38: 99-108https://doi.org/10.12750/JARB.38.3.99

Table 1 . Primers used for GST_hEPO screening PCR analysis and quantitative PCR analysis of specific genes.

GenePrimer nameSequence (5’ to 3’)
Primers used for GST_hEPO screening PCR analysis
Mouse β-casein 5’ armm C5 CV S5 βATAAGAACTGCAGTGGGATTCTTC
m C3 GST AS9 βAGCATTGAAATCTCTGCACGCTC
m C5 CV S6 βGTCTACCAATTCACTCTAGAAGTG
m C3 GST AS7 βACGTATGATGGCCATAGACTGTG
Primers used for quantitative real-time PCR analysis of MMR-related gene, Rad51, and DNA Ligase IV gene
Rplp0mRplp0 FCGACCTGGAAGTCCAACTA
mRplp0 RATCTGCTGCATCTGCTTG
MMR-related gene (Msh2, Msh3, Msh6, Mlh1, Pms2)mMsh2 CDS STGAAGTTGGACATGGCAGCA
mMsh2 CDS ASTAATGCGGCCAGAGACTGAG
mMsh3 CDS SCCATCGCCTATGCAACTCTA
mMsh3 CDS ASTCACAGACTGGTGGATAGTG
mMsh6 CDS SATACTCAGGCATGCAACAGC
mMsh6 CDS ASTCAAAAGTTGCGGTGCCTCT
mMlh1 CDS SAGATTAGTGAGCGGTGCCAT
mMlh1 CDS ASACTGAGGATTCACACAGCCC
mPms2 CDS SACTTCCAGGACGCCACAAAA
mPms2 CDS ASAACTGCCTGTCTGTTGCACT
HR-related gene Rad51Rad51 CDS SAATTCCGAACTGGGAAGACAC
Rad51 CDS ASTCACCTCCACCACGGTCAAT
NHEJ-related geneqPCR Ligase IV (CDS) STCCACAGGAAGGCTCTCTCA
DNA Ligase IVqPCR Ligase IV (CDS) ASTCTCACCGTCAAGGATGCAC

References

  1. Banerjee S and Flores-Rozas H. 2005. Cadmium inhibits mismatch repair by blocking the ATPase activity of the MSH2-MSH6 complex. Nucleic Acids Res. 33:1410-1419. (Erratum published 2005, Nucleic Acids Res. 33:1738).
    Pubmed KoreaMed CrossRef
  2. Barjhoux I, Gonzalez P, Cachot J. 2016. Molecular and phenotypic responses of Japanese medaka (Oryzias latipes) early life stages to environmental concentrations of cadmium in sediment. Environ. Sci. Pollut. Res. Int. 23:17969-17981.
    Pubmed CrossRef
  3. Chakraborty U and Alani E. 2016. Understanding how mismatch repair proteins participate in the repair/anti-recombination decision. FEMS Yeast Res. 16:fow071.
    Pubmed KoreaMed CrossRef
  4. Chen YY, Chan KM. 2014. Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells. Aquat. Toxicol. 157:196-206.
    Pubmed CrossRef
  5. Chidambaram A, Sekar A, S H K, Chidambaram RK, Arunachalam K, Vilwanathan R. 2017. Synthesis, characterization, and evaluation of Cd[L-proline]2, a novel histone deacetylase inhibitor that induces epigenetic modification of histone deacetylase isoforms in A549 cells. Invest. New Drugs 35:691-705.
    Pubmed CrossRef
  6. Clark AB and Kunkel TA. 2004. Cadmium inhibits the functions of eukaryotic MutS complexes. J. Biol. Chem. 279:53903-53906.
    Pubmed CrossRef
  7. Elliott B and Jasin M. 2001. Repair of double-strand breaks by homologous recombination in mismatch repair-defective mammalian cells. Mol. Cell. Biol. 21:2671-2682.
    Pubmed KoreaMed CrossRef
  8. Fishel R and Wilson T. 1997. MutS homologs in mammalian cells. Curr. Opin. Genet. Dev. 7:105-113.
    Pubmed CrossRef
  9. Goldfarb T and Alani E. 2005. Distinct roles for the Saccharomyces cerevisiae mismatch repair proteins in heteroduplex rejection, mismatch repair and nonhomologous tail removal. Genetics 169:563-574.
    Pubmed KoreaMed CrossRef
  10. Habraken Y, Sung P, Prakash S. 1996. Binding of insertion/deletion DNA mismatches by the heterodimer of yeast mismatch repair proteins MSH2 and MSH3. Curr. Biol. 6:1185-1187.
    Pubmed CrossRef
  11. Jayathilaka K, Sheridan SD, Bold TD, Bochenska K, Logan HL, Weichselbaum RR, Connell PP. 2008. A chemical compound that stimulates the human homologous recombination protein RAD51. Proc. Natl. Acad. Sci. U. S. A. 105:15848-15853.
    Pubmed KoreaMed CrossRef
  12. Jin YH, Clark AB, Slebos RJ, Al-Refai H, Taylor JA, Kunkel TA, Gordenin DA. 2003. Cadmium is a mutagen that acts by inhibiting mismatch repair. Nat. Genet. 34:326-329.
    Pubmed KoreaMed CrossRef
  13. Kim SY, Kim GY, Kang MJ. 2022. Relationship between DNA mismatch repair and CRISPR/Cas9-mediated knock-in in the bovine β-casein gene locus. Anim. Biosci. 35:126-137.
    Pubmed KoreaMed CrossRef
  14. Kunkel TA and Erie DA. 2015. Eukaryotic mismatch repair in relation to DNA replication. Annu. Rev. Genet. 49:291-313.
    Pubmed KoreaMed CrossRef
  15. Lahue RS, Modrich P. 1989. DNA mismatch correction in a defined system. Science 245:160-164.
    Pubmed CrossRef
  16. Li GM. 2008. Mechanisms and functions of DNA mismatch repair. Cell Res. 18:85-98.
    Pubmed CrossRef
  17. Li W, Gu X, Zhang X, Kong J, Ding N, Qi Y, Zhang Y, Huang D. 2015. Cadmium delays non-homologous end joining (NHEJ) repair via inhibition of DNA-PKcs phosphorylation and downregulation of XRCC4 and Ligase IV. Mutat. Res. 779:112-123.
    Pubmed CrossRef
  18. Long DT, Räschle M, Walter JC. 2011. Mechanism of RAD51-dependent DNA interstrand cross-link repair. Science 333:84-87.
    Pubmed KoreaMed CrossRef
  19. Lützen A, Rasmussen LJ. 2004. Cadmium inhibits human DNA mismatch repair in vivo. Biochem. Biophys. Res. Commun. 321:21-25.
    Pubmed CrossRef
  20. Mao Z, Bozzella M, Gorbunova V. 2008. DNA repair by nonhomologous end joining and homologous recombination during cell cycle in human cells. Cell Cycle 7:2902-2906.
    Pubmed KoreaMed CrossRef
  21. Marra G, Iaccarino I, Lettieri T, Roscilli G, Jiricny J. 1998. Mismatch repair deficiency associated with overexpression of the MSH3 gene. Proc. Natl. Acad. Sci. U. S. A. 95:8568-8573.
    Pubmed KoreaMed CrossRef
  22. Maruyama T, Dougan SK, Truttmann MC, Bilate AM, Ploegh HL. 2015. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat. Biotechnol. 33:538-542. (Erratum published 2016, Nat. Biotechnol. 34:210).
    Pubmed KoreaMed CrossRef
  23. Ochi T, Wu Q, Chirgadze DY, Grossmann JG, Blundell TL. 2012. Structural insights into the role of domain flexibility in human DNA ligase IV. Structure 20:1212-1222.
    Pubmed KoreaMed CrossRef
  24. Selva EM, Lahue RS. 1997. Differential effects of the mismatch repair genes MSH2 and MSH3 on homeologous recombination in Saccharomyces cerevisiae. Mol. Gen. Genet. 257:71-82.
    Pubmed CrossRef
  25. Sherrer SM, Modrich P. 2018. The mutagen and carcinogen cadmium is a high-affinity inhibitor of the zinc-dependent MutLα endonuclease. Proc. Natl. Acad. Sci. U. S. A. 115:7314-7319.
    Pubmed KoreaMed CrossRef
  26. Song J, Yang D, Xu J, Zhu T, Zhang J. 2016. RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency. Nat. Commun. 7:10548.
    Pubmed KoreaMed CrossRef
  27. Spies M and Fishel R. 2015. Mismatch repair during homologous and homeologous recombination. Cold Spring Harb. Perspect. Biol. 7:a022657.
    Pubmed KoreaMed CrossRef
  28. Stauffer ME and Chazin WJ. 2004. Physical interaction between replication protein A and Rad51 promotes exchange on single-stranded DNA. J. Biol. Chem. 279:25638-25645.
    Pubmed CrossRef
  29. Vasquez KM, Marburger K, Wilson JH. 2001. Manipulating the mammalian genome by homologous recombination. Proc. Natl. Acad. Sci. U. S. A. 98:8403-8410.
    Pubmed KoreaMed CrossRef
  30. Yang Q, Zhang R, Wang XW, Linke SP, Sengupta S, Hickson ID, Pedrazzi G, Perrera C, Stagljar I, Littman SJ, Harris CC. 2004. The mismatch DNA repair heterodimer, hMSH2/6, regulates BLM helicase. Oncogene 23:3749-3756.
    Pubmed CrossRef

JARB Journal of Animal Reproduction and Biotehnology

qr code

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663