JARB Journal of Animal Reproduction and Biotehnology

qr code
Download

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663

Article Search

Original Article

Article Original Article
Split Viewer

Journal of Animal Reproduction and Biotechnology 2023; 38(3): 167-176

Published online September 30, 2023

https://doi.org/10.12750/JARB.38.3.167

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

A rare ginsenoside compound K (CK) induces apoptosis for breast cancer cells

Seun Eui Kim1,2,# , Myoung-Hoon Lee1 , Hye-Myoung Jang3 , Wan-Taek Im2 , Joontaik Lee2 , Sang-Hwan Kim4 and Gwang Joo Jeon2,3,*,#

1Genuine Research, Seoul 06040, Korea
2Department of Biotechnology, Hankyong National University, Ansung 17579, Korea
3Genomic Informatics Center, Hankyong National University, Ansung 17579, Korea
4School of Animal Life Convergence Science, Hankyong National University, Ansung, 17579, Korea

Correspondence to: Gwang Joo Jeon
E-mail: jeon5894@gmail.com

#These authors contributed equally as first authors.

Received: September 11, 2023; Revised: September 18, 2023; Accepted: September 18, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background: A breast cancer is the second leading cause of cancer death in women worldwide and among different types of breast cancers, triple-negative breast cancer (TNBC) has a poor prognosis.
Methods: We investigated the potential of ginsenoside compound K (CK), an active ingredient in the bio-transformed ginsenoside, to be used as a therapeutic ingredient by examining the effects of CK on cell proliferation, apoptosis, and cancer-related gene expressions in breast cancer cells.
Results: From the results of treating MCF-7, an ER and PR-positive breast cancer cells, and MDA-MB-231 (TNBC) with CK at a concentration of 0-100 μM, the half maximal inhibitory concentration (IC50) values for each cell were 52.17 μM and 29.88 μM, respectively. And also, it was confirmed that cell migration was inhibited above the IC50 concentration. In addition, fluorescence analysis of Apoptosis/Necrosis showed that CK induced apoptosis rather than necrosis of breast cancer cells. Through qPCR, it was confirmed that the expression of genes related to apoptosis and cell cycle arrest was increased in CK-treated breast cancer cells, and it acted more effectively on TNBC. However, the expression of genes related to tumor invasion and metastasis is also increased, so it is necessary to consider the timing of application of CK as a potential therapeutic anticancer compound.
Conclusions: CK showed a stronger inhibitory effect in TNBC with poor prognosis but considering the high tumor invasion and metastasis-related gene expression, the timing of application of CK should be considered.

Keywords: breast cancer, compound K, gene expression, ginsenoside

INTRODUCTION

Breast cancer is a serious disease and is the second leading cause of cancer death among women worldwide (Sung et al., 2021). Breast cancer is classified mostly according to the receptors such as Estrogen (ER), Progesterone (PR), Human epidermal growth factor-2 (HER2) receptors expressed in the cells. Triple-negative breast cancer (TNBC), in which ER, PR, and HER2 receptors are all negative, accounts for about 15-20% of all breast cancers (American cancer society, 2022). TNBC is known to have a poor prognosis compared to other breast cancers such as ER or PR positive breast cancer and HER2 positive breast cancer (DeSantis et al., 2019). Since the term TNBC was first used in 2004, no specific treatment has been developed except for cytotoxic anticancer drugs (Collignon et al., 2016; Tarantino et al., 2022), and patients suffer from side effects until the tumor become resistant to the drugs and eventually succumb to the disease. After all, the key task of cancer treatment is to find therapeutic agents that are less toxic to patients and have excellent therapeutic effects (Nakhjavani et al., 2019).

Ginseng has various pharmacological effects and has been used as a traditional medicine for a long time and is also widely used as a health supplement due to its excellent nutritional value. So far, almost 200 types of ginseng active ingredients, ginsenosides, have been reported (Ratan et al., 2021), and the best pharmacologically active substance is ginsenoside of the triterpene saponin group (Li et al., 2019b). In order for ginsenosides to be absorbed into the body, metabolism by intestinal microbes should be prioritized (Fukami et al., 2019; Jin et al., 2019; Yang et al., 2020). Compound K (CK, 20-o-beta-dglucopyranosyl-20 (S)-protopanaxadiol, C36H62O8) is a major deglycosylated metabolite of active ginseng substances converted into rare ginsenosides by human intestinal bacteria, and has high biological activities such as anticancer, antidiabetic, and anti-inflammatory (Liu et al., 2022). Several studies have reported the anticarcinogenic effects of CK on lung cancer (Chen et al., 2019), non-small cell lung cancer (Li et al., 2019a), liver cancer (Zhang et al., 2018), colon cancer (Yao et al., 2018), glioblastoma (Lee et al., 2017), gastric carcinoma (Hu et al., 2012), nasopharyngeal carcinoma (Law et al., 2014), bladder cancer (Wang et al., 2013), acute myeloid leukemia (Chen et al., 2013), multiple myeloma (Park et al., 2011), and breast cancer (Kwak et al., 2015; Choi et al., 2019). We have studied to investigate the effects of CK on the two breast cancer cell lines of MCF-7 and MDA-MB-231. Their proliferation, metastasis, apoptosis and gene expression on the apoptotic pathway were studied. Especially, MDA-MB-231 is the TNBC cells

MATERIALS AND METHODS

Preparation of CK

CK powder was made from ginseng using recombinant β-glucosidase, which was was provided by Ace-emzyme co., ltd, Korea. CK powder was dissolved in DMSO to prepare a 100 mM solution, and then diluted again with 20, 40, 60, 80 mM and stored at -20℃ until use.

Cell culture and CK treatment

The breast cancer cell lines MCF-7 (KCLB 30022) and MDA-MB-231 (KCLB 30026) were purchased in a frozen state from the Korean cell line bank. These frozen cells were thawed at 37℃ and put into a T-25 cell culture flask containing RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), respectively, and cultured at 37℃ and 5% CO2 condition for 24 hours. Then, it was transferred to an appropriate well plate according to the experimental conditions and subcultured, and the CK solution was treated at a ratio of 1 µL per 1 mL of the culture medium.

IC50 assay

Cells grown for 24 hours in a medium having a final CK concentration of 0-100 µM were treated with EZ-Cytox and cultured for 2 hours, and then the OD values were measured at 450 nm. Cell viability (%) was calculated as a ratio of the OD value of the CK-treated cells to the OD value measured in the control group. Based on this, half maximal inhibitory concentration (IC50) values of CK for breast cancer cells were measured.

Cell migration assay

When more than 80-90% of cells were proliferated in the 6 well-plate, the existing medium was removed and a new medium with a CK concentration of 0-100 µM was added. Then, a 200 µL tip was used to scrape the center of the cell monolayer in one line to make a wound. The width of the wound was measured while observing with a phase-contrast inverted microscope at 200x, and the width was again measured after incubation for 48 hours and compared.

Fluorescence analysis of apoptosis and necrosis

When the cells proliferated to about 67-70% in a 24-well plate, the medium was replaced with a new medium containing a CK solution having an IC50 concentration corresponding to each breast cancer cells, and the cells were cultured again for 24 hours. After removing all the culture medium and washing the cells twice with phosphate buffered solution (PBS) and assay buffer, a buffer solution containing Apopxin Green Indicator (abcam) and 7-AAD (abcam) was added, and the cells were left at room temperature for 30 minutes for staining. After washing twice with assay buffer again, the images were observed and taken under a fluorescence microscope and the images were merged using the Image J program and analyzed.

Genetic analysis using qPCR

A total RNAs were extracted from cells treated with IC50 concentration of CK using an AccuPrep® Universal RNA extraction Kit (Bioneer), and then cDNAs were synthesized using an PrimeScript IITM RT Reagent Kit (TaKaRa bio). Then, quantitative polymerase chain reaction (qPCR) was performed with the primers listed in Table 1 and KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems).

Table 1 . List of primers used in this study

PrimerSequence (5’ to 3’)
ForwardReverse
BAK1rCCTCTGCAACCTAGCAGCACCAAGTTCAGGGCTGCCACCCAG
Caspase 3CATAAAAGCACTGGAATGACATCGCCAAGAATAATAACCAGG
Caspase 9CAGAAAGACCATGGGTTTGAGAAACAGCATTAGCGACCC
Caspase 12GAAGCCATGGCTGATGAGACTGAACTCAGCTGTTTTTTGG
P21GGCAGACCAGCATGACAGATTTCTGGGTGAATTTCATAACCGCCTGT
P53GTCTGTGACTTGCACGTACTCCCCCCGTCCCAGTAGATTACCACTGGA
CD1GCCCTCTGTGCCACAGATGTGACTTCTGGTATCAAAATGCTCCGGA
CDK4GGCACTTACACCCGTGGTTGTTACAGAGTGCTGCAGAGCTCGAAAGG
mTORGGAAACATCCTTTAATCAGGCCTATGACAGCGTATCTCTGGATGCTGAGG
RaptorCACATCGTGAGTGTGAGCGTCAATCTAAGGCAGCAGCCAACGTTCA
H-RasGAATACGACCCCACTATAGAGGATTCCTAGAAGGCATCCTCCACTCCCTG
K-RasCATCAGCAAAGACAAGACAGGGTGTCAGTTTCTTTTTCACAGGCATTGCT
N-RasTCAGCCAAGACCAGACAGGGTGTCAGATGAAAAACCTGGGGTGGC
MMP2CTTCTTCTTCAAGGACCGGTTCATTCTTGAAGAAGTAGCTGTGACCGCC
MMP9GCTGTATTTGTTCAAGGATGGGAAGTGGCAGAAATAGGCTTTCTCTCGGT
GAPDHGTATCGTGGAAGGACTCATGACCACGCCAAATTCGTTGTCATACCAGGAA

RESULTS AND DISCUSSION

Cell viability of CK-treated breast cancer cells and IC50 concentration of CK

The cell viability of MCF-7, an ER and PR-positive breast cancer cells, was 95.5% when exposed to 40 µM of CK compared to the control group, but decreased sharply to 20.7% when exposed to 60 µM of CK. After that, when exposed to 80 µM or more of CK, the cell viability was 9.9%, hardly surviving. Therefore, the IC50 concentration of CK against MCF-7 cells was confirmed to be 52.17 µM (Fig. 1A and 1B). On the other hand, TNBC, MDA-MB-231, showed a lower cell viability than MCF-7 when exposed to CK treatment. The cell viability was decreased to 82.2% when exposed to 20 µM CK and decreased significantly to 17.0% when exposed to 40 µM CK. The IC50 concentration of CK against MDA-MB-231 cells was 29.88 µM (Fig. 1C and 1D).

Figure 1. Cell viability of CK-treated MCF-7 and MDA-MB-231 cells and the IC50 concentration of CK (A, C) Cell viability (%) of each breast cancer cells. (B, D) Mean OD value of each breast cancer cells (mean ± SE).

Therefore, it was shown that CK significantly inhibits the survival of breast cancer cells and acts more effectively against MDA-MB-231, a triple-negative breast cancer cells, than MCF-7, an ER and PR-positive breast cancer cells.

Cell migration inhibitory effect of CK on breast cancer cells

After applying a physical wound to the breast cancer cell monolayer, the degree of cell migration was analyzed by observing the change in the wound under CK 0-100 µM exposure conditions. As shown in Fig. 2, wound closure close to 100% was observed in both types of breast cancer cells after 48 hours when CK was not treated. However, for MCF-7 cells, the width of wound did not decrease when the concentration of CK was increased, and in the cells treated with CK of 40 µM or higher, they did not adhere to the bottom of the cell culture plate and suspended. In the CK 100 µM treatment group, all cells were suspended, so the photograph was not shown. In MDA-MB-231 cells, the wound width did not decrease when the CK concentration increased. MDA-MB-231 was more sensitive to CK, and cell scattering appeared from 20 µM of CK. Considering that the IC50 concentrations of CK for these two breast cancer cells are 52.17 µM and 29.88 µM, respectively, it seems that cell adhesion disappears around these concentrations and cell migration begins to be strongly inhibited.

Figure 2. Migration assay results of breast cancer cells treated with CK (200×).

Apoptosis and necrosis of breast cancer cells treated with CK

In both types of breast cancer cells, apoptosis/necrosis staining was not easy because most of the cells did not survive and fell off the bottom of the cell culture plate in CK at IC50 concentration (Fig. 3, 4). Nevertheless, it was confirmed that apoptosis (green fluorescence) was in progress in most cells, and the location was different from the cells in which necrosis (red fluorescence) was observed. Also, apoptosis was more advanced in MDA-MB-231 cells than in MCF-7 cells. Necrosis was not observed in both cells, so it was inferred that CK induces apoptosis rather than necrosis.

Figure 3. Fluorescence analysis of apoptosis/necrosis in MCF-7 cells treated with IC50 CK concentrations (BF, Bright field; Apopxin Green, cells undergoing apoptosis show green fluorescence; 7-AAD, cells undergoing necrosis show red fluorescence; BF+ Apopxin Green+7-AAD, the photos of the above three conditions were merged) (400×).
Figure 4. Fluorescence analysis of apoptosis/necrosis in MDA-MB-231 cells treated with IC50 CK concentrations (BF, Bright field; Apopxin Green, cells undergoing apoptosis show green fluorescence; 7-AAD, cells undergoing necrosis show red fluorescence; BF+ Apopxin Green+7-AAD, the photos of the above three conditions were merged) (400×).

Cancer-related gene expression in CK-treated breast cancer cells

The expression of BAK1, caspase 3, -9, and -12 genes related to the apoptosis signaling pathway were all increased in CK-treated cells compared to the untreated control cells. The expression levels of the genes were significantly higher in MDA-MB-231 cells than in MCF-7 cells (Fig. 5A and 5E). This suggests that CK activated caspase 12 in the intrinsic pathway and caspase 9 and caspase 3, which are downstream effectors in turn (Galluzzi et al., 2018; Wu et al., 2020). Successively, it seems that the expression of BAK1, a pro-apoptotic gene of the mitochondrial pathway, has increased. Expression of p21, p53, CD1, and CDK4 genes, which are cell cycle-related genes, was checked in CK-treated cells (Fig. 5B and 5F). In MCF-7 cells treated with CK, the expression of the three genes except for CD1 was increased, and in MDA-MB-231 cells treated with CK, the expression of all genes was significantly increased. p21 and p53 are tumor suppressor genes related to tumor suppressor proteins and cyclin-dependent kinase (CDK) inhibitors, and these two proteins are known to bind to each other to prevent metastasis and recurrence of cancer (Gartel et al., 1996; Gartel et al., 1998). As a primary cancer suppressor, p53 inhibits tumor growth by acting as a proliferation inhibitor and eliminator of anomalous cells (Jassim et al., 2021). CD1 (cyclin D1) and CDK4 (cyclin dependent kinase 4) genes inhibit the formation of CDK4/CD1 complex by interfering with the binding of CD1 and CDK in the G1 phase of the cell cycle, thereby preventing progression to the S phase (Sung et al., 2000). Therefore, CK suppresses the proliferation of breast cancer cells in the pre-mitotic stage, and appears to act strongly on MDA-MB-231 cells in particular. Activation of mTOR (rapamycin mammalian target) signaling is closely related to cancer and may promote proliferation of tumor by increasing protein synthesis and inhibiting autophagy (Chiang and Abraham, 2007; Xu et al., 2014). And Raptor (regulation-related protein of mTOR) gene is known to play an essential role in mTOR signaling (Shin et al., 2011; Hare and Harvey, 2017). mTOR expression in breast cancer cells correlates with a poorer prognosis (Ueng et al., 2012; Wazir et al., 2013). CK increased the expression of these two genes in breast cancer cells and also increased the expression of the oncogene Ras (Fig. 5C and 5G). In this experiment, the expression of structurally and functionally similar H-, K-, and N-Ras genes were all observed. In CK-treated MCF-7 cells, the expression of K-Ras gene was similar to that of the CK-untreated cells, while the expression of H-, and N-Ras genes was increased. Hua et al. (1997) reported that transformation into cancer cells was induced only when the Ras gene expression was at least 100 times greater than that of normal cells in vitro. Therefore, in the case of breast cancer cells that have already progressed to cancer cells, additional studies are needed to elucidate the meaning of Ras gene expression increase by CK treatment. Proteolytic enzymes MMPs (matrix metalloproteinases) are closely related to tumor invasion and metastasis (Hanemaaijer et al., 2000), so the lower the expression of the MMP2 and MMP9 genes, the better the anticancer effect. However, when breast cancer cells were treated with CK, the expression of these genes was strong, and in particular, the expression was increased about 6-fold or more in MDA-MB-231 cells (Fig. 5D and 5H). Overall, this means that although CK has excellent effects such as apoptosis and inhibition of cell division in breast cancer cells, it may promote or not inhibit tumor invasion and metastasis.

Figure 5. Expression of cancer-related gene in CK-treated breast cancer cells.

CONCLUSION

When ER and PR positive breast cancer cells MCF-7 and triple negative breast cancer cells MDA-MB-231 were treated with CK at 0, 20, 40, 60, 80, and 100 µM, cell viability decreased with increasing concentration. And the IC50 concentrations of CK for both cells were 52.17 µM and 29.88 µM, respectively. As a result of observing cell changes after wounding the cell monolayer, MDA-MB-231 cell migration was reduced at a lower CK concentration than that of MCF-7. This was consistent with the IC50 concentration of CK on breast cancer cells. Through fluorescence analysis of apoptosis/necrosis and cancer-related gene expression analysis, CK activated the intrinsic apoptotic pathway of breast cancer cells and inhibited the proliferation of the cancer cells by blocking the progression of cell division. This effect was stronger in triple-negative breast cancer, which is known to have a poor prognosis. However, it also appears to increase the expression of genes related to tumor invasion and metastasis, so it is necessary to consider the timing of application of CK during breast cancer progression.

Author Contributions

Conceptualization, S.E.K., G.J.J.; data curation, S.E.K., M-H.L.; formal analysis, S.E.K., H-M.J., W-T.I, J.L.; funding acquisition, G.J.J.; investigation, S.E.K., M-H.L.; methodology, S.E.K., M-H.L., J.L.; project administration, G.J.J.; resources, S.E.K., H-M.J., G.J.J., W-T.I.; supervision, G.J.J.; roles/writing - original draft, S.E.K., M-H.L., J.L.; writing - review & editing, S-H.K., G.J.J.

Funding

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through High Value-added Food Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (321038-5).

References

  1. American Cancer Society. 2022. About breast cancer. Cancer.org. Retrieved October 7, 2022. from https://www.cancer.org/content/dam/CRC/PDF/Public/8577.00.pdf
  2. Chen HF, Wu LX, Li XF, Zhu YC, Wang WX, Xu CW, Huang ZZ, Du KQ. 2019. Ginsenoside compound K inhibits growth of lung cancer cells via HIF-1α-mediated glucose metabolism. Cell. Mol. Biol. (Noisy-le-grand) 65:48-52.
    Pubmed CrossRef
  3. Chen Y, Xu Y, Zhu Y, Li X. 2013. Anti-cancer effects of ginsenoside compound k on pediatric acute myeloid leukemia cells. Cancer Cell Int. 13:24.
    Pubmed KoreaMed CrossRef
  4. Chiang GG and Abraham RT. 2007. Targeting the mTOR signaling network in cancer. Trends Mol. Med. 13:433-442.
    Pubmed CrossRef
  5. Choi E, Kim E, Kim JH, Yoon K, Kim S, Lee J, Cho JY. 2019. AKT1-targeted proapoptotic activity of compound K in human breast cancer cells. J. Ginseng Res. 43:692-698.
    Pubmed KoreaMed CrossRef
  6. Collignon J, Lousberg L, Schroeder H, Jerusalem G. 2016. Triple-negative breast cancer: treatment challenges and solutions. Breast Cancer (Dove Med. Press) 8:93-107.
    Pubmed KoreaMed CrossRef
  7. DeSantis CE, Ma J, Gaudet MM, Newman LA, Miller KD, Goding Sauer A, Jemal A, Siegel RL. 2019. Breast cancer statistics, 2019. CA Cancer J. Clin. 69:438-451.
    Pubmed CrossRef
  8. Fukami H, Ueda T, Matsuoka N. 2019. Pharmacokinetic study of compound K in Japanese subjects after ingestion of Panax ginseng fermented by Lactobacillus paracasei A221 reveals significant increase of absorption into blood. J. Med. Food 22:257-263.
    Pubmed CrossRef
  9. Galluzzi L, Vitale I, Aaronson SA, Abrams JM, Adam D, Agostinis P, Alnemri ES, Altucci L, Amelio I, Andrews DW, Annicchiarico-Petruzzelli M, Antonov AV, Arama E, Baehrecke EH, Barlev NA, Bazan NG, Bernassola F, Bertrand MJM, Bianchi K, Blagosklonny MV, Blomgren K, Borner C, Boya P, Brenner C, Campanella M, Candi E, Carmona-Gutierrez D, Cecconi F, Chan FK, Chandel NS, Cheng EH, Chipuk JE, Cidlowski JA, Ciechanover A, Cohen GM, Conrad M, Cubillos-Ruiz JR, Czabotar PE, D'Angiolella V, Dawson TM, Dawson VL, De Laurenzi V, De Maria R, Debatin KM, DeBerardinis RJ, Deshmukh M, Di Daniele N, Di Virgilio F, Dixit VM, Dixon SJ, Duckett CS, Dynlacht BD, El-Deiry WS, Elrod JW, Fimia GM, Fulda S, García-Sáez AJ, Garg AD, Garrido C, Gavathiotis E, Golstein P, Gottlieb E, Green DR, Greene LA, Gronemeyer H, Gross A, Hajnoczky G, Hardwick JM, Harris IS, Hengartner MO, Hetz C, Ichijo H, Jäättelä M, Joseph B, Jost PJ, Juin PP, Kaiser WJ, Karin M, Kaufmann T, Kepp O, Kimchi A, Kitsis RN, Klionsky DJ, Knight RA, Kumar S, Lee SW, Lemasters JJ, Levine B, Linkermann A, Lipton SA, Lockshin RA, López-Otín C, Lowe SW, Luedde T, Lugli E, MacFarlane M, Madeo F, Malewicz M, Malorni W, Manic G, Marine JC, Martin SJ, Martinou JC, Medema JP, Mehlen P, Meier P, Melino S, Miao EA, Molkentin JD, Moll UM, Muñoz-Pinedo C, Nagata S, Nuñez G, Oberst A, Oren M, Overholtzer M, Pagano M, Panaretakis T, Pasparakis M, Penninger JM, Pereira DM, Pervaiz S, Peter ME, Piacentini M, Pinton P, Prehn JHM, Puthalakath H, Rabinovich GA, Rehm M, Rizzuto R, Rodrigues CMP, Rubinsztein DC, Rudel T, Ryan KM, Sayan E, Scorrano L, Shao F, Shi Y, Silke J, Simon HU, Sistigu A, Stockwell BR, Strasser A, Szabadkai G, Tait SWG, Tang D, Tavernarakis N, Thorburn A, Tsujimoto Y, Turk B, Vanden Berghe T, Vandenabeele P, Vander Heiden MG, Villunger A, Virgin HW, Vousden KH, Vucic D, Wagner EF, Walczak H, Wallach D, Wang Y, Wells JA, Wood W, Yuan J, Zakeri Z, Zhivotovsky B, Zitvogel L, Melino G, Kroemer G. 2018. Molecular mechanisms of cell death: recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ. 25:486-541.
    Pubmed KoreaMed CrossRef
  10. Gartel AL, Serfas MS, Tyner AL. 1996. p21--negative regulator of the cell cycle. Proc. Soc. Exp. Biol. Med. 213:138-149.
    Pubmed CrossRef
  11. Gartel AL and Tyner AL. 1998. The growth-regulatory role of p21 (WAF1/CIP1). Prog. Mol. Subcell. Biol. 20:43-71.
    Pubmed CrossRef
  12. Hanemaaijer R, Verheijen JH, Maguire TM, Visser H, Toet K, McDermott E, O'Higgins N, Duffy MJ. 2000. Increased gelatinase-A and gelatinase-B activities in malignant vs. benign breast tumors. Int. J. Cancer 86:204-207.
    Pubmed CrossRef
  13. Hare SH and Harvey AJ. 2017. mTOR function and therapeutic targeting in breast cancer. Am. J. Cancer Res. 7:383-404.
    Pubmed KoreaMed
  14. Hua VY, Wang WK, Duesberg PH. 1997. Dominant transformation by mutated human ras genes in vitro requires more than 100 times higher expression than is observed in cancers. Proc. Natl. Acad. Sci. U. S. A. 94:9614-9619.
    Pubmed KoreaMed CrossRef
  15. Hu C, Song G, Zhang B, Liu Z, Chen R, Zhang H, Hu T. 2012. Intestinal metabolite compound K of panaxoside inhibits the growth of gastric carcinoma by augmenting apoptosis via Bid-mediated mitochondrial pathway. J. Cell. Mol. Med. 16:96-106.
    Pubmed KoreaMed CrossRef
  16. Jassim MMA, Rasool KH, Mahmood MM. 2021. p53, p21, and cyclin d1 protein expression patterns in patients with breast cancer. Vet. World 14:2833-2838.
    Pubmed KoreaMed CrossRef
  17. Jin S, Jeon JH, Lee S, Kang WY, Seong SJ, Yoon YR, Choi MK, Song IS. 2019. Detection of 13 ginsenosides (Rb1, Rb2, Rc, Rd, Re, Rf, Rg1, Rg3, Rh2, F1, compound K, 20(S)-protopanaxadiol, and 20(S)-protopanaxatriol) in human plasma and application of the analytical method to human pharmacokinetic studies following two week-repeated administration of red ginseng extract. Molecules 24:2618.
    Pubmed KoreaMed CrossRef
  18. Kwak CW, Son YM, Gu MJ, Kim G, Lee IK, Kye YC, Kim HW, Song KD, Chu H, Park BC, Lee HK, Yang DC, Sprent J, Yun CH. 2015. A bacterial metabolite, compound K, induces programmed necrosis in MCF-7 cells via GSK3β. J. Microbiol. Biotechnol. 25:1170-1176.
    Pubmed CrossRef
  19. Law CK, Kwok HH, Poon PY, Lau CC, Jiang ZH, Tai WC, Hsiao WW, Mak NK, Yue PY, Wong RN. 2014. Ginsenoside compound K induces apoptosis in nasopharyngeal carcinoma cells via activation of apoptosis-inducing factor. Chin. Med. 9:11.
    Pubmed KoreaMed CrossRef
  20. Lee S, Kwon MC, Jang JP, Sohng JK, Jung HJ. 2017. The ginsenoside metabolite compound K inhibits growth, migration and stemness of glioblastoma cells. Int. J. Oncol. 51:414-424.
    Pubmed KoreaMed CrossRef
  21. Li C, Dong Y, Wang L, Xu G, Yang Q, Tang X, Qiao Y, Cong Z. 2019a. Ginsenoside metabolite compound K induces apoptosis and autophagy in non-small cell lung cancer cells via AMPK-mTOR and JNK pathways. Biochem. Cell Biol. 97:406-414.
    Pubmed CrossRef
  22. Li D, Wu Y, Zhang C, Sun J, Zhou Z, Lu W. 2019b. Production of triterpene ginsenoside compound K in the non-conventional yeast Yarrowia lipolytica. J. Agric. Food Chem. 67:2581-2588.
    Pubmed CrossRef
  23. Liu T, Zhu L, Wang L. 2022. A narrative review of the pharmacology of ginsenoside compound K. Ann. Transl. Med. 10:234.
    Pubmed KoreaMed CrossRef
  24. Nakhjavani M, Hardingham JE, Palethorpe HM, Tomita Y, Smith E, Price TJ, Townsend AR. 2019. Ginsenoside Rg3: potential molecular targets and therapeutic indication in metastatic breast cancer. Medicines (Basel) 6:17.
    Pubmed KoreaMed CrossRef
  25. Park S, Lee HJ, Jeong SJ, Song HS, Kim M, Lee HJ, Lee EO, Kim DH, Ahn KS, Kim SH. 2011. Inhibition of JAK1/STAT3 signaling mediates compound K-induced apoptosis in human multiple myeloma U266 cells. Food Chem. Toxicol. 49:1367-1372.
    Pubmed CrossRef
  26. Ratan ZA, Haidere MF, Hong YH, Park SH, Lee JO, Lee J, Cho JY. 2021. Pharmacological potential of ginseng and its major component ginsenosides. J. Ginseng Res. 45:199-210.
    Pubmed KoreaMed CrossRef
  27. Shin HY, Chu SH, Lee H, Lee JW. 2011. mTOR inhibitor as a potential drug of age-related disease. Korean J. Clin. Geriatr. 12:149-159.
  28. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. 2021. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 71:209-249.
    Pubmed CrossRef
  29. Sung ND, Kim MR, Ha JH, Kwon BM, Chung HW, Ahn BT, Ryu SY. 2000. Searching of cyclin-dependent kinase 4/Cyclin D1 enzyme inhibition materials from the native plants. J. Korean. Soc. Agric. Chem. Biotechnol. 43:174-178.
  30. Tarantino P, Corti C, Schmid P, Cortes J, Mittendorf EA, Rugo H, Tolaney SM, Bianchini G, Andrè F, Curigliano G. 2022. Immunotherapy for early triple negative breast cancer: research agenda for the next decade. NPJ Breast Cancer 8:23.
    Pubmed KoreaMed CrossRef
  31. Ueng SH, Chen SC, Chang YS, Hsueh S, Lin YC, Chien HP, Lo YF, Shen SC, Hsueh C. 2012. Phosphorylated mTOR expression correlates with poor outcome in early-stage triple negative breast carcinomas. Int. J. Clin. Exp. Pathol. 5:806-813.
    Pubmed KoreaMed
  32. Wang H, Jiang D, Liu J, Ye S, Xiao S, Wang W, Sun Z, Xie Y, Wang J. 2013. Compound K induces apoptosis of bladder cancer T24 cells via reactive oxygen species-mediated p38 MAPK pathway. Cancer Biother. Radiopharm. 28:607-614.
    Pubmed KoreaMed CrossRef
  33. Wazir U, Newbold RF, Jiang WG, Sharma AK, Mokbel K. 2013. Prognostic and therapeutic implications of mTORC1 and Rictor expression in human breast cancer. Oncol. Rep. 29:1969-1974.
    Pubmed CrossRef
  34. Wu H, Guo H, Liu H, Cui H, Fang J, Zuo Z, Deng J, Li Y, Wang X, Zhao L. 2020. Copper sulfate-induced endoplasmic reticulum stress promotes hepatic apoptosis by activating CHOP, JNK and caspase-12 signaling pathways. Ecotoxicol. Environ. Saf. 191:110236.
    Pubmed CrossRef
  35. Xu K, Liu P, Wei W. 2014. mTOR signaling in tumorigenesis. Biochim. Biophys. Acta 1846:638-654.
    Pubmed KoreaMed CrossRef
  36. Yang Y, Liu X, Li S, Chen Y, Zhao Y, Wei Y, Qiu Y, Liu Y, Zhou Z, Han J, Wu G, Ding Q. 2020. Genome-scale CRISPR screening for potential targets of ginsenoside compound K. Cell Death Dis. 11:39.
    Pubmed KoreaMed CrossRef
  37. Yao H, Wan JY, Zeng J, Huang WH, Sava-Segal C, Li L, Niu X, Wang Q, Wang CZ, Yuan CS. 2018. Effects of compound K, an enteric microbiome metabolite of ginseng, in the treatment of inflammation associated colon cancer. Oncol. Lett. 15:8339-8348.
    Pubmed KoreaMed CrossRef
  38. Zhang X, Zhang S, Sun Q, Jiao W, Yan Y, Zhang X. 2018. Compound K induces endoplasmic reticulum stress and apoptosis in human liver cancer cells by regulating STAT3. Molecules 23:1482.
    Pubmed KoreaMed CrossRef

Article

Original Article

Journal of Animal Reproduction and Biotechnology 2023; 38(3): 167-176

Published online September 30, 2023 https://doi.org/10.12750/JARB.38.3.167

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

A rare ginsenoside compound K (CK) induces apoptosis for breast cancer cells

Seun Eui Kim1,2,# , Myoung-Hoon Lee1 , Hye-Myoung Jang3 , Wan-Taek Im2 , Joontaik Lee2 , Sang-Hwan Kim4 and Gwang Joo Jeon2,3,*,#

1Genuine Research, Seoul 06040, Korea
2Department of Biotechnology, Hankyong National University, Ansung 17579, Korea
3Genomic Informatics Center, Hankyong National University, Ansung 17579, Korea
4School of Animal Life Convergence Science, Hankyong National University, Ansung, 17579, Korea

Correspondence to:Gwang Joo Jeon
E-mail: jeon5894@gmail.com

#These authors contributed equally as first authors.

Received: September 11, 2023; Revised: September 18, 2023; Accepted: September 18, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background: A breast cancer is the second leading cause of cancer death in women worldwide and among different types of breast cancers, triple-negative breast cancer (TNBC) has a poor prognosis.
Methods: We investigated the potential of ginsenoside compound K (CK), an active ingredient in the bio-transformed ginsenoside, to be used as a therapeutic ingredient by examining the effects of CK on cell proliferation, apoptosis, and cancer-related gene expressions in breast cancer cells.
Results: From the results of treating MCF-7, an ER and PR-positive breast cancer cells, and MDA-MB-231 (TNBC) with CK at a concentration of 0-100 μM, the half maximal inhibitory concentration (IC50) values for each cell were 52.17 μM and 29.88 μM, respectively. And also, it was confirmed that cell migration was inhibited above the IC50 concentration. In addition, fluorescence analysis of Apoptosis/Necrosis showed that CK induced apoptosis rather than necrosis of breast cancer cells. Through qPCR, it was confirmed that the expression of genes related to apoptosis and cell cycle arrest was increased in CK-treated breast cancer cells, and it acted more effectively on TNBC. However, the expression of genes related to tumor invasion and metastasis is also increased, so it is necessary to consider the timing of application of CK as a potential therapeutic anticancer compound.
Conclusions: CK showed a stronger inhibitory effect in TNBC with poor prognosis but considering the high tumor invasion and metastasis-related gene expression, the timing of application of CK should be considered.

Keywords: breast cancer, compound K, gene expression, ginsenoside

INTRODUCTION

Breast cancer is a serious disease and is the second leading cause of cancer death among women worldwide (Sung et al., 2021). Breast cancer is classified mostly according to the receptors such as Estrogen (ER), Progesterone (PR), Human epidermal growth factor-2 (HER2) receptors expressed in the cells. Triple-negative breast cancer (TNBC), in which ER, PR, and HER2 receptors are all negative, accounts for about 15-20% of all breast cancers (American cancer society, 2022). TNBC is known to have a poor prognosis compared to other breast cancers such as ER or PR positive breast cancer and HER2 positive breast cancer (DeSantis et al., 2019). Since the term TNBC was first used in 2004, no specific treatment has been developed except for cytotoxic anticancer drugs (Collignon et al., 2016; Tarantino et al., 2022), and patients suffer from side effects until the tumor become resistant to the drugs and eventually succumb to the disease. After all, the key task of cancer treatment is to find therapeutic agents that are less toxic to patients and have excellent therapeutic effects (Nakhjavani et al., 2019).

Ginseng has various pharmacological effects and has been used as a traditional medicine for a long time and is also widely used as a health supplement due to its excellent nutritional value. So far, almost 200 types of ginseng active ingredients, ginsenosides, have been reported (Ratan et al., 2021), and the best pharmacologically active substance is ginsenoside of the triterpene saponin group (Li et al., 2019b). In order for ginsenosides to be absorbed into the body, metabolism by intestinal microbes should be prioritized (Fukami et al., 2019; Jin et al., 2019; Yang et al., 2020). Compound K (CK, 20-o-beta-dglucopyranosyl-20 (S)-protopanaxadiol, C36H62O8) is a major deglycosylated metabolite of active ginseng substances converted into rare ginsenosides by human intestinal bacteria, and has high biological activities such as anticancer, antidiabetic, and anti-inflammatory (Liu et al., 2022). Several studies have reported the anticarcinogenic effects of CK on lung cancer (Chen et al., 2019), non-small cell lung cancer (Li et al., 2019a), liver cancer (Zhang et al., 2018), colon cancer (Yao et al., 2018), glioblastoma (Lee et al., 2017), gastric carcinoma (Hu et al., 2012), nasopharyngeal carcinoma (Law et al., 2014), bladder cancer (Wang et al., 2013), acute myeloid leukemia (Chen et al., 2013), multiple myeloma (Park et al., 2011), and breast cancer (Kwak et al., 2015; Choi et al., 2019). We have studied to investigate the effects of CK on the two breast cancer cell lines of MCF-7 and MDA-MB-231. Their proliferation, metastasis, apoptosis and gene expression on the apoptotic pathway were studied. Especially, MDA-MB-231 is the TNBC cells

MATERIALS AND METHODS

Preparation of CK

CK powder was made from ginseng using recombinant β-glucosidase, which was was provided by Ace-emzyme co., ltd, Korea. CK powder was dissolved in DMSO to prepare a 100 mM solution, and then diluted again with 20, 40, 60, 80 mM and stored at -20℃ until use.

Cell culture and CK treatment

The breast cancer cell lines MCF-7 (KCLB 30022) and MDA-MB-231 (KCLB 30026) were purchased in a frozen state from the Korean cell line bank. These frozen cells were thawed at 37℃ and put into a T-25 cell culture flask containing RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), respectively, and cultured at 37℃ and 5% CO2 condition for 24 hours. Then, it was transferred to an appropriate well plate according to the experimental conditions and subcultured, and the CK solution was treated at a ratio of 1 µL per 1 mL of the culture medium.

IC50 assay

Cells grown for 24 hours in a medium having a final CK concentration of 0-100 µM were treated with EZ-Cytox and cultured for 2 hours, and then the OD values were measured at 450 nm. Cell viability (%) was calculated as a ratio of the OD value of the CK-treated cells to the OD value measured in the control group. Based on this, half maximal inhibitory concentration (IC50) values of CK for breast cancer cells were measured.

Cell migration assay

When more than 80-90% of cells were proliferated in the 6 well-plate, the existing medium was removed and a new medium with a CK concentration of 0-100 µM was added. Then, a 200 µL tip was used to scrape the center of the cell monolayer in one line to make a wound. The width of the wound was measured while observing with a phase-contrast inverted microscope at 200x, and the width was again measured after incubation for 48 hours and compared.

Fluorescence analysis of apoptosis and necrosis

When the cells proliferated to about 67-70% in a 24-well plate, the medium was replaced with a new medium containing a CK solution having an IC50 concentration corresponding to each breast cancer cells, and the cells were cultured again for 24 hours. After removing all the culture medium and washing the cells twice with phosphate buffered solution (PBS) and assay buffer, a buffer solution containing Apopxin Green Indicator (abcam) and 7-AAD (abcam) was added, and the cells were left at room temperature for 30 minutes for staining. After washing twice with assay buffer again, the images were observed and taken under a fluorescence microscope and the images were merged using the Image J program and analyzed.

Genetic analysis using qPCR

A total RNAs were extracted from cells treated with IC50 concentration of CK using an AccuPrep® Universal RNA extraction Kit (Bioneer), and then cDNAs were synthesized using an PrimeScript IITM RT Reagent Kit (TaKaRa bio). Then, quantitative polymerase chain reaction (qPCR) was performed with the primers listed in Table 1 and KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems).

Table 1. List of primers used in this study.

PrimerSequence (5’ to 3’)
ForwardReverse
BAK1rCCTCTGCAACCTAGCAGCACCAAGTTCAGGGCTGCCACCCAG
Caspase 3CATAAAAGCACTGGAATGACATCGCCAAGAATAATAACCAGG
Caspase 9CAGAAAGACCATGGGTTTGAGAAACAGCATTAGCGACCC
Caspase 12GAAGCCATGGCTGATGAGACTGAACTCAGCTGTTTTTTGG
P21GGCAGACCAGCATGACAGATTTCTGGGTGAATTTCATAACCGCCTGT
P53GTCTGTGACTTGCACGTACTCCCCCCGTCCCAGTAGATTACCACTGGA
CD1GCCCTCTGTGCCACAGATGTGACTTCTGGTATCAAAATGCTCCGGA
CDK4GGCACTTACACCCGTGGTTGTTACAGAGTGCTGCAGAGCTCGAAAGG
mTORGGAAACATCCTTTAATCAGGCCTATGACAGCGTATCTCTGGATGCTGAGG
RaptorCACATCGTGAGTGTGAGCGTCAATCTAAGGCAGCAGCCAACGTTCA
H-RasGAATACGACCCCACTATAGAGGATTCCTAGAAGGCATCCTCCACTCCCTG
K-RasCATCAGCAAAGACAAGACAGGGTGTCAGTTTCTTTTTCACAGGCATTGCT
N-RasTCAGCCAAGACCAGACAGGGTGTCAGATGAAAAACCTGGGGTGGC
MMP2CTTCTTCTTCAAGGACCGGTTCATTCTTGAAGAAGTAGCTGTGACCGCC
MMP9GCTGTATTTGTTCAAGGATGGGAAGTGGCAGAAATAGGCTTTCTCTCGGT
GAPDHGTATCGTGGAAGGACTCATGACCACGCCAAATTCGTTGTCATACCAGGAA

RESULTS AND DISCUSSION

Cell viability of CK-treated breast cancer cells and IC50 concentration of CK

The cell viability of MCF-7, an ER and PR-positive breast cancer cells, was 95.5% when exposed to 40 µM of CK compared to the control group, but decreased sharply to 20.7% when exposed to 60 µM of CK. After that, when exposed to 80 µM or more of CK, the cell viability was 9.9%, hardly surviving. Therefore, the IC50 concentration of CK against MCF-7 cells was confirmed to be 52.17 µM (Fig. 1A and 1B). On the other hand, TNBC, MDA-MB-231, showed a lower cell viability than MCF-7 when exposed to CK treatment. The cell viability was decreased to 82.2% when exposed to 20 µM CK and decreased significantly to 17.0% when exposed to 40 µM CK. The IC50 concentration of CK against MDA-MB-231 cells was 29.88 µM (Fig. 1C and 1D).

Figure 1.Cell viability of CK-treated MCF-7 and MDA-MB-231 cells and the IC50 concentration of CK (A, C) Cell viability (%) of each breast cancer cells. (B, D) Mean OD value of each breast cancer cells (mean ± SE).

Therefore, it was shown that CK significantly inhibits the survival of breast cancer cells and acts more effectively against MDA-MB-231, a triple-negative breast cancer cells, than MCF-7, an ER and PR-positive breast cancer cells.

Cell migration inhibitory effect of CK on breast cancer cells

After applying a physical wound to the breast cancer cell monolayer, the degree of cell migration was analyzed by observing the change in the wound under CK 0-100 µM exposure conditions. As shown in Fig. 2, wound closure close to 100% was observed in both types of breast cancer cells after 48 hours when CK was not treated. However, for MCF-7 cells, the width of wound did not decrease when the concentration of CK was increased, and in the cells treated with CK of 40 µM or higher, they did not adhere to the bottom of the cell culture plate and suspended. In the CK 100 µM treatment group, all cells were suspended, so the photograph was not shown. In MDA-MB-231 cells, the wound width did not decrease when the CK concentration increased. MDA-MB-231 was more sensitive to CK, and cell scattering appeared from 20 µM of CK. Considering that the IC50 concentrations of CK for these two breast cancer cells are 52.17 µM and 29.88 µM, respectively, it seems that cell adhesion disappears around these concentrations and cell migration begins to be strongly inhibited.

Figure 2.Migration assay results of breast cancer cells treated with CK (200×).

Apoptosis and necrosis of breast cancer cells treated with CK

In both types of breast cancer cells, apoptosis/necrosis staining was not easy because most of the cells did not survive and fell off the bottom of the cell culture plate in CK at IC50 concentration (Fig. 3, 4). Nevertheless, it was confirmed that apoptosis (green fluorescence) was in progress in most cells, and the location was different from the cells in which necrosis (red fluorescence) was observed. Also, apoptosis was more advanced in MDA-MB-231 cells than in MCF-7 cells. Necrosis was not observed in both cells, so it was inferred that CK induces apoptosis rather than necrosis.

Figure 3.Fluorescence analysis of apoptosis/necrosis in MCF-7 cells treated with IC50 CK concentrations (BF, Bright field; Apopxin Green, cells undergoing apoptosis show green fluorescence; 7-AAD, cells undergoing necrosis show red fluorescence; BF+ Apopxin Green+7-AAD, the photos of the above three conditions were merged) (400×).
Figure 4.Fluorescence analysis of apoptosis/necrosis in MDA-MB-231 cells treated with IC50 CK concentrations (BF, Bright field; Apopxin Green, cells undergoing apoptosis show green fluorescence; 7-AAD, cells undergoing necrosis show red fluorescence; BF+ Apopxin Green+7-AAD, the photos of the above three conditions were merged) (400×).

Cancer-related gene expression in CK-treated breast cancer cells

The expression of BAK1, caspase 3, -9, and -12 genes related to the apoptosis signaling pathway were all increased in CK-treated cells compared to the untreated control cells. The expression levels of the genes were significantly higher in MDA-MB-231 cells than in MCF-7 cells (Fig. 5A and 5E). This suggests that CK activated caspase 12 in the intrinsic pathway and caspase 9 and caspase 3, which are downstream effectors in turn (Galluzzi et al., 2018; Wu et al., 2020). Successively, it seems that the expression of BAK1, a pro-apoptotic gene of the mitochondrial pathway, has increased. Expression of p21, p53, CD1, and CDK4 genes, which are cell cycle-related genes, was checked in CK-treated cells (Fig. 5B and 5F). In MCF-7 cells treated with CK, the expression of the three genes except for CD1 was increased, and in MDA-MB-231 cells treated with CK, the expression of all genes was significantly increased. p21 and p53 are tumor suppressor genes related to tumor suppressor proteins and cyclin-dependent kinase (CDK) inhibitors, and these two proteins are known to bind to each other to prevent metastasis and recurrence of cancer (Gartel et al., 1996; Gartel et al., 1998). As a primary cancer suppressor, p53 inhibits tumor growth by acting as a proliferation inhibitor and eliminator of anomalous cells (Jassim et al., 2021). CD1 (cyclin D1) and CDK4 (cyclin dependent kinase 4) genes inhibit the formation of CDK4/CD1 complex by interfering with the binding of CD1 and CDK in the G1 phase of the cell cycle, thereby preventing progression to the S phase (Sung et al., 2000). Therefore, CK suppresses the proliferation of breast cancer cells in the pre-mitotic stage, and appears to act strongly on MDA-MB-231 cells in particular. Activation of mTOR (rapamycin mammalian target) signaling is closely related to cancer and may promote proliferation of tumor by increasing protein synthesis and inhibiting autophagy (Chiang and Abraham, 2007; Xu et al., 2014). And Raptor (regulation-related protein of mTOR) gene is known to play an essential role in mTOR signaling (Shin et al., 2011; Hare and Harvey, 2017). mTOR expression in breast cancer cells correlates with a poorer prognosis (Ueng et al., 2012; Wazir et al., 2013). CK increased the expression of these two genes in breast cancer cells and also increased the expression of the oncogene Ras (Fig. 5C and 5G). In this experiment, the expression of structurally and functionally similar H-, K-, and N-Ras genes were all observed. In CK-treated MCF-7 cells, the expression of K-Ras gene was similar to that of the CK-untreated cells, while the expression of H-, and N-Ras genes was increased. Hua et al. (1997) reported that transformation into cancer cells was induced only when the Ras gene expression was at least 100 times greater than that of normal cells in vitro. Therefore, in the case of breast cancer cells that have already progressed to cancer cells, additional studies are needed to elucidate the meaning of Ras gene expression increase by CK treatment. Proteolytic enzymes MMPs (matrix metalloproteinases) are closely related to tumor invasion and metastasis (Hanemaaijer et al., 2000), so the lower the expression of the MMP2 and MMP9 genes, the better the anticancer effect. However, when breast cancer cells were treated with CK, the expression of these genes was strong, and in particular, the expression was increased about 6-fold or more in MDA-MB-231 cells (Fig. 5D and 5H). Overall, this means that although CK has excellent effects such as apoptosis and inhibition of cell division in breast cancer cells, it may promote or not inhibit tumor invasion and metastasis.

Figure 5.Expression of cancer-related gene in CK-treated breast cancer cells.

CONCLUSION

When ER and PR positive breast cancer cells MCF-7 and triple negative breast cancer cells MDA-MB-231 were treated with CK at 0, 20, 40, 60, 80, and 100 µM, cell viability decreased with increasing concentration. And the IC50 concentrations of CK for both cells were 52.17 µM and 29.88 µM, respectively. As a result of observing cell changes after wounding the cell monolayer, MDA-MB-231 cell migration was reduced at a lower CK concentration than that of MCF-7. This was consistent with the IC50 concentration of CK on breast cancer cells. Through fluorescence analysis of apoptosis/necrosis and cancer-related gene expression analysis, CK activated the intrinsic apoptotic pathway of breast cancer cells and inhibited the proliferation of the cancer cells by blocking the progression of cell division. This effect was stronger in triple-negative breast cancer, which is known to have a poor prognosis. However, it also appears to increase the expression of genes related to tumor invasion and metastasis, so it is necessary to consider the timing of application of CK during breast cancer progression.

Acknowledgements

None.

Author Contributions

Conceptualization, S.E.K., G.J.J.; data curation, S.E.K., M-H.L.; formal analysis, S.E.K., H-M.J., W-T.I, J.L.; funding acquisition, G.J.J.; investigation, S.E.K., M-H.L.; methodology, S.E.K., M-H.L., J.L.; project administration, G.J.J.; resources, S.E.K., H-M.J., G.J.J., W-T.I.; supervision, G.J.J.; roles/writing - original draft, S.E.K., M-H.L., J.L.; writing - review & editing, S-H.K., G.J.J.

Funding

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through High Value-added Food Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (321038-5).

Ethical Approval

Institutional Animal Care and Use Committee of Yonsei University (No. YWC-P120).

Consent to Participate

Not applicable.

Consent to Publish

Not applicable.

Availability of Data and Materials

Not applicable.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig 1.

Download
Figure 1.Cell viability of CK-treated MCF-7 and MDA-MB-231 cells and the IC50 concentration of CK (A, C) Cell viability (%) of each breast cancer cells. (B, D) Mean OD value of each breast cancer cells (mean ± SE).
Journal of Animal Reproduction and Biotechnology 2023; 38: 167-176https://doi.org/10.12750/JARB.38.3.167

Fig 2.

Download
Figure 2.Migration assay results of breast cancer cells treated with CK (200×).
Journal of Animal Reproduction and Biotechnology 2023; 38: 167-176https://doi.org/10.12750/JARB.38.3.167

Fig 3.

Download
Figure 3.Fluorescence analysis of apoptosis/necrosis in MCF-7 cells treated with IC50 CK concentrations (BF, Bright field; Apopxin Green, cells undergoing apoptosis show green fluorescence; 7-AAD, cells undergoing necrosis show red fluorescence; BF+ Apopxin Green+7-AAD, the photos of the above three conditions were merged) (400×).
Journal of Animal Reproduction and Biotechnology 2023; 38: 167-176https://doi.org/10.12750/JARB.38.3.167

Fig 4.

Download
Figure 4.Fluorescence analysis of apoptosis/necrosis in MDA-MB-231 cells treated with IC50 CK concentrations (BF, Bright field; Apopxin Green, cells undergoing apoptosis show green fluorescence; 7-AAD, cells undergoing necrosis show red fluorescence; BF+ Apopxin Green+7-AAD, the photos of the above three conditions were merged) (400×).
Journal of Animal Reproduction and Biotechnology 2023; 38: 167-176https://doi.org/10.12750/JARB.38.3.167

Fig 5.

Download
Figure 5.Expression of cancer-related gene in CK-treated breast cancer cells.
Journal of Animal Reproduction and Biotechnology 2023; 38: 167-176https://doi.org/10.12750/JARB.38.3.167

Table 1 . List of primers used in this study.

PrimerSequence (5’ to 3’)
ForwardReverse
BAK1rCCTCTGCAACCTAGCAGCACCAAGTTCAGGGCTGCCACCCAG
Caspase 3CATAAAAGCACTGGAATGACATCGCCAAGAATAATAACCAGG
Caspase 9CAGAAAGACCATGGGTTTGAGAAACAGCATTAGCGACCC
Caspase 12GAAGCCATGGCTGATGAGACTGAACTCAGCTGTTTTTTGG
P21GGCAGACCAGCATGACAGATTTCTGGGTGAATTTCATAACCGCCTGT
P53GTCTGTGACTTGCACGTACTCCCCCCGTCCCAGTAGATTACCACTGGA
CD1GCCCTCTGTGCCACAGATGTGACTTCTGGTATCAAAATGCTCCGGA
CDK4GGCACTTACACCCGTGGTTGTTACAGAGTGCTGCAGAGCTCGAAAGG
mTORGGAAACATCCTTTAATCAGGCCTATGACAGCGTATCTCTGGATGCTGAGG
RaptorCACATCGTGAGTGTGAGCGTCAATCTAAGGCAGCAGCCAACGTTCA
H-RasGAATACGACCCCACTATAGAGGATTCCTAGAAGGCATCCTCCACTCCCTG
K-RasCATCAGCAAAGACAAGACAGGGTGTCAGTTTCTTTTTCACAGGCATTGCT
N-RasTCAGCCAAGACCAGACAGGGTGTCAGATGAAAAACCTGGGGTGGC
MMP2CTTCTTCTTCAAGGACCGGTTCATTCTTGAAGAAGTAGCTGTGACCGCC
MMP9GCTGTATTTGTTCAAGGATGGGAAGTGGCAGAAATAGGCTTTCTCTCGGT
GAPDHGTATCGTGGAAGGACTCATGACCACGCCAAATTCGTTGTCATACCAGGAA

References

  1. American Cancer Society. 2022. About breast cancer. Cancer.org. Retrieved October 7, 2022. from https://www.cancer.org/content/dam/CRC/PDF/Public/8577.00.pdf
  2. Chen HF, Wu LX, Li XF, Zhu YC, Wang WX, Xu CW, Huang ZZ, Du KQ. 2019. Ginsenoside compound K inhibits growth of lung cancer cells via HIF-1α-mediated glucose metabolism. Cell. Mol. Biol. (Noisy-le-grand) 65:48-52.
    Pubmed CrossRef
  3. Chen Y, Xu Y, Zhu Y, Li X. 2013. Anti-cancer effects of ginsenoside compound k on pediatric acute myeloid leukemia cells. Cancer Cell Int. 13:24.
    Pubmed KoreaMed CrossRef
  4. Chiang GG and Abraham RT. 2007. Targeting the mTOR signaling network in cancer. Trends Mol. Med. 13:433-442.
    Pubmed CrossRef
  5. Choi E, Kim E, Kim JH, Yoon K, Kim S, Lee J, Cho JY. 2019. AKT1-targeted proapoptotic activity of compound K in human breast cancer cells. J. Ginseng Res. 43:692-698.
    Pubmed KoreaMed CrossRef
  6. Collignon J, Lousberg L, Schroeder H, Jerusalem G. 2016. Triple-negative breast cancer: treatment challenges and solutions. Breast Cancer (Dove Med. Press) 8:93-107.
    Pubmed KoreaMed CrossRef
  7. DeSantis CE, Ma J, Gaudet MM, Newman LA, Miller KD, Goding Sauer A, Jemal A, Siegel RL. 2019. Breast cancer statistics, 2019. CA Cancer J. Clin. 69:438-451.
    Pubmed CrossRef
  8. Fukami H, Ueda T, Matsuoka N. 2019. Pharmacokinetic study of compound K in Japanese subjects after ingestion of Panax ginseng fermented by Lactobacillus paracasei A221 reveals significant increase of absorption into blood. J. Med. Food 22:257-263.
    Pubmed CrossRef
  9. Galluzzi L, Vitale I, Aaronson SA, Abrams JM, Adam D, Agostinis P, Alnemri ES, Altucci L, Amelio I, Andrews DW, Annicchiarico-Petruzzelli M, Antonov AV, Arama E, Baehrecke EH, Barlev NA, Bazan NG, Bernassola F, Bertrand MJM, Bianchi K, Blagosklonny MV, Blomgren K, Borner C, Boya P, Brenner C, Campanella M, Candi E, Carmona-Gutierrez D, Cecconi F, Chan FK, Chandel NS, Cheng EH, Chipuk JE, Cidlowski JA, Ciechanover A, Cohen GM, Conrad M, Cubillos-Ruiz JR, Czabotar PE, D'Angiolella V, Dawson TM, Dawson VL, De Laurenzi V, De Maria R, Debatin KM, DeBerardinis RJ, Deshmukh M, Di Daniele N, Di Virgilio F, Dixit VM, Dixon SJ, Duckett CS, Dynlacht BD, El-Deiry WS, Elrod JW, Fimia GM, Fulda S, García-Sáez AJ, Garg AD, Garrido C, Gavathiotis E, Golstein P, Gottlieb E, Green DR, Greene LA, Gronemeyer H, Gross A, Hajnoczky G, Hardwick JM, Harris IS, Hengartner MO, Hetz C, Ichijo H, Jäättelä M, Joseph B, Jost PJ, Juin PP, Kaiser WJ, Karin M, Kaufmann T, Kepp O, Kimchi A, Kitsis RN, Klionsky DJ, Knight RA, Kumar S, Lee SW, Lemasters JJ, Levine B, Linkermann A, Lipton SA, Lockshin RA, López-Otín C, Lowe SW, Luedde T, Lugli E, MacFarlane M, Madeo F, Malewicz M, Malorni W, Manic G, Marine JC, Martin SJ, Martinou JC, Medema JP, Mehlen P, Meier P, Melino S, Miao EA, Molkentin JD, Moll UM, Muñoz-Pinedo C, Nagata S, Nuñez G, Oberst A, Oren M, Overholtzer M, Pagano M, Panaretakis T, Pasparakis M, Penninger JM, Pereira DM, Pervaiz S, Peter ME, Piacentini M, Pinton P, Prehn JHM, Puthalakath H, Rabinovich GA, Rehm M, Rizzuto R, Rodrigues CMP, Rubinsztein DC, Rudel T, Ryan KM, Sayan E, Scorrano L, Shao F, Shi Y, Silke J, Simon HU, Sistigu A, Stockwell BR, Strasser A, Szabadkai G, Tait SWG, Tang D, Tavernarakis N, Thorburn A, Tsujimoto Y, Turk B, Vanden Berghe T, Vandenabeele P, Vander Heiden MG, Villunger A, Virgin HW, Vousden KH, Vucic D, Wagner EF, Walczak H, Wallach D, Wang Y, Wells JA, Wood W, Yuan J, Zakeri Z, Zhivotovsky B, Zitvogel L, Melino G, Kroemer G. 2018. Molecular mechanisms of cell death: recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ. 25:486-541.
    Pubmed KoreaMed CrossRef
  10. Gartel AL, Serfas MS, Tyner AL. 1996. p21--negative regulator of the cell cycle. Proc. Soc. Exp. Biol. Med. 213:138-149.
    Pubmed CrossRef
  11. Gartel AL and Tyner AL. 1998. The growth-regulatory role of p21 (WAF1/CIP1). Prog. Mol. Subcell. Biol. 20:43-71.
    Pubmed CrossRef
  12. Hanemaaijer R, Verheijen JH, Maguire TM, Visser H, Toet K, McDermott E, O'Higgins N, Duffy MJ. 2000. Increased gelatinase-A and gelatinase-B activities in malignant vs. benign breast tumors. Int. J. Cancer 86:204-207.
    Pubmed CrossRef
  13. Hare SH and Harvey AJ. 2017. mTOR function and therapeutic targeting in breast cancer. Am. J. Cancer Res. 7:383-404.
    Pubmed KoreaMed
  14. Hua VY, Wang WK, Duesberg PH. 1997. Dominant transformation by mutated human ras genes in vitro requires more than 100 times higher expression than is observed in cancers. Proc. Natl. Acad. Sci. U. S. A. 94:9614-9619.
    Pubmed KoreaMed CrossRef
  15. Hu C, Song G, Zhang B, Liu Z, Chen R, Zhang H, Hu T. 2012. Intestinal metabolite compound K of panaxoside inhibits the growth of gastric carcinoma by augmenting apoptosis via Bid-mediated mitochondrial pathway. J. Cell. Mol. Med. 16:96-106.
    Pubmed KoreaMed CrossRef
  16. Jassim MMA, Rasool KH, Mahmood MM. 2021. p53, p21, and cyclin d1 protein expression patterns in patients with breast cancer. Vet. World 14:2833-2838.
    Pubmed KoreaMed CrossRef
  17. Jin S, Jeon JH, Lee S, Kang WY, Seong SJ, Yoon YR, Choi MK, Song IS. 2019. Detection of 13 ginsenosides (Rb1, Rb2, Rc, Rd, Re, Rf, Rg1, Rg3, Rh2, F1, compound K, 20(S)-protopanaxadiol, and 20(S)-protopanaxatriol) in human plasma and application of the analytical method to human pharmacokinetic studies following two week-repeated administration of red ginseng extract. Molecules 24:2618.
    Pubmed KoreaMed CrossRef
  18. Kwak CW, Son YM, Gu MJ, Kim G, Lee IK, Kye YC, Kim HW, Song KD, Chu H, Park BC, Lee HK, Yang DC, Sprent J, Yun CH. 2015. A bacterial metabolite, compound K, induces programmed necrosis in MCF-7 cells via GSK3β. J. Microbiol. Biotechnol. 25:1170-1176.
    Pubmed CrossRef
  19. Law CK, Kwok HH, Poon PY, Lau CC, Jiang ZH, Tai WC, Hsiao WW, Mak NK, Yue PY, Wong RN. 2014. Ginsenoside compound K induces apoptosis in nasopharyngeal carcinoma cells via activation of apoptosis-inducing factor. Chin. Med. 9:11.
    Pubmed KoreaMed CrossRef
  20. Lee S, Kwon MC, Jang JP, Sohng JK, Jung HJ. 2017. The ginsenoside metabolite compound K inhibits growth, migration and stemness of glioblastoma cells. Int. J. Oncol. 51:414-424.
    Pubmed KoreaMed CrossRef
  21. Li C, Dong Y, Wang L, Xu G, Yang Q, Tang X, Qiao Y, Cong Z. 2019a. Ginsenoside metabolite compound K induces apoptosis and autophagy in non-small cell lung cancer cells via AMPK-mTOR and JNK pathways. Biochem. Cell Biol. 97:406-414.
    Pubmed CrossRef
  22. Li D, Wu Y, Zhang C, Sun J, Zhou Z, Lu W. 2019b. Production of triterpene ginsenoside compound K in the non-conventional yeast Yarrowia lipolytica. J. Agric. Food Chem. 67:2581-2588.
    Pubmed CrossRef
  23. Liu T, Zhu L, Wang L. 2022. A narrative review of the pharmacology of ginsenoside compound K. Ann. Transl. Med. 10:234.
    Pubmed KoreaMed CrossRef
  24. Nakhjavani M, Hardingham JE, Palethorpe HM, Tomita Y, Smith E, Price TJ, Townsend AR. 2019. Ginsenoside Rg3: potential molecular targets and therapeutic indication in metastatic breast cancer. Medicines (Basel) 6:17.
    Pubmed KoreaMed CrossRef
  25. Park S, Lee HJ, Jeong SJ, Song HS, Kim M, Lee HJ, Lee EO, Kim DH, Ahn KS, Kim SH. 2011. Inhibition of JAK1/STAT3 signaling mediates compound K-induced apoptosis in human multiple myeloma U266 cells. Food Chem. Toxicol. 49:1367-1372.
    Pubmed CrossRef
  26. Ratan ZA, Haidere MF, Hong YH, Park SH, Lee JO, Lee J, Cho JY. 2021. Pharmacological potential of ginseng and its major component ginsenosides. J. Ginseng Res. 45:199-210.
    Pubmed KoreaMed CrossRef
  27. Shin HY, Chu SH, Lee H, Lee JW. 2011. mTOR inhibitor as a potential drug of age-related disease. Korean J. Clin. Geriatr. 12:149-159.
  28. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. 2021. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 71:209-249.
    Pubmed CrossRef
  29. Sung ND, Kim MR, Ha JH, Kwon BM, Chung HW, Ahn BT, Ryu SY. 2000. Searching of cyclin-dependent kinase 4/Cyclin D1 enzyme inhibition materials from the native plants. J. Korean. Soc. Agric. Chem. Biotechnol. 43:174-178.
  30. Tarantino P, Corti C, Schmid P, Cortes J, Mittendorf EA, Rugo H, Tolaney SM, Bianchini G, Andrè F, Curigliano G. 2022. Immunotherapy for early triple negative breast cancer: research agenda for the next decade. NPJ Breast Cancer 8:23.
    Pubmed KoreaMed CrossRef
  31. Ueng SH, Chen SC, Chang YS, Hsueh S, Lin YC, Chien HP, Lo YF, Shen SC, Hsueh C. 2012. Phosphorylated mTOR expression correlates with poor outcome in early-stage triple negative breast carcinomas. Int. J. Clin. Exp. Pathol. 5:806-813.
    Pubmed KoreaMed
  32. Wang H, Jiang D, Liu J, Ye S, Xiao S, Wang W, Sun Z, Xie Y, Wang J. 2013. Compound K induces apoptosis of bladder cancer T24 cells via reactive oxygen species-mediated p38 MAPK pathway. Cancer Biother. Radiopharm. 28:607-614.
    Pubmed KoreaMed CrossRef
  33. Wazir U, Newbold RF, Jiang WG, Sharma AK, Mokbel K. 2013. Prognostic and therapeutic implications of mTORC1 and Rictor expression in human breast cancer. Oncol. Rep. 29:1969-1974.
    Pubmed CrossRef
  34. Wu H, Guo H, Liu H, Cui H, Fang J, Zuo Z, Deng J, Li Y, Wang X, Zhao L. 2020. Copper sulfate-induced endoplasmic reticulum stress promotes hepatic apoptosis by activating CHOP, JNK and caspase-12 signaling pathways. Ecotoxicol. Environ. Saf. 191:110236.
    Pubmed CrossRef
  35. Xu K, Liu P, Wei W. 2014. mTOR signaling in tumorigenesis. Biochim. Biophys. Acta 1846:638-654.
    Pubmed KoreaMed CrossRef
  36. Yang Y, Liu X, Li S, Chen Y, Zhao Y, Wei Y, Qiu Y, Liu Y, Zhou Z, Han J, Wu G, Ding Q. 2020. Genome-scale CRISPR screening for potential targets of ginsenoside compound K. Cell Death Dis. 11:39.
    Pubmed KoreaMed CrossRef
  37. Yao H, Wan JY, Zeng J, Huang WH, Sava-Segal C, Li L, Niu X, Wang Q, Wang CZ, Yuan CS. 2018. Effects of compound K, an enteric microbiome metabolite of ginseng, in the treatment of inflammation associated colon cancer. Oncol. Lett. 15:8339-8348.
    Pubmed KoreaMed CrossRef
  38. Zhang X, Zhang S, Sun Q, Jiao W, Yan Y, Zhang X. 2018. Compound K induces endoplasmic reticulum stress and apoptosis in human liver cancer cells by regulating STAT3. Molecules 23:1482.
    Pubmed KoreaMed CrossRef

Article Tools

PDF print Article
Export to Citation Open Access
Google Scholar Send to Email

Share this article on :

Stats or Metrics

Related articles in JARB

more

© 2019. The Korean Society of Animal Reproduction and Biotechnology.

JARB Journal of Animal Reproduction and Biotehnology

qr code

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663