JARB Journal of Animal Reproduction and Biotehnology

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663

Article Search

Original Article

Article Original Article
Split Viewer

Journal of Animal Reproduction and Biotechnology 2023; 38(4): 199-208

Published online December 31, 2023

https://doi.org/10.12750/JARB.38.4.199

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Vitamin C promotes the early reprogramming of fetal canine fibroblasts into induced pluripotent stem cells

Sang Eun Kim1,2,# , Jun Sung Lee1,# , Keon Bong Oh2 and Jeong Ho Hwang3,*

1Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 05020, Korea
2Animal Biotechnology Division, National Institute of Animal Science, Rural Development Administration, Wanju 55365, Korea
3Animal Model Research Group, Jeonbuk Branch, Korea Institute of Toxicology, Jeongeup 56212, Korea

Correspondence to: Jeong Ho Hwang
E-mail: jeongho.hwang@kitox.re.kr

#These authors contributed equally to this work.

Received: September 15, 2023; Revised: October 27, 2023; Accepted: November 7, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background: Canine induced pluripotent stem cells (iPSCs) are an attractive source for veterinary regenerative medicine, disease modeling, and drug development. Here we used vitamin C (Vc) to improve the reprogramming efficiency of canine iPSCs, and its functions in the reprogramming process were elucidated.
Methods: Retroviral transduction of Oct4, Sox2, Klf4, c-Myc (OSKM), and GFP was employed to induce reprogramming in canine fetal fibroblasts. Following transduction, the culture medium was subsequently replaced with ESC medium containing Vc to determine the effect on reprogramming activity.
Results: The number of AP-positive iPSC colonies dramatically increased in culture conditions supplemented with Vc. Vc enhanced the efficacy of retrovirus transduction, which appears to be correlated with enhanced cell proliferation capacity. To confirm the characteristics of the Vc-treated iPSCs, the cells were cultured to passage 5, and pluripotency markers including Oct4, Sox2, Nanog, and Tra-1-60 were observed by immunocytochemistry. The expression of endogenous pluripotent genes (Oct4, Nanog, Rex1, and telomerase) were also verified by PCR. The complete silencing of exogenously transduced human OSKM factors was observed exclusively in canine iPSCs treated with Vc. Canine iPSCs treated with Vc are capable of forming embryoid bodies in vitro and have spontaneously differentiated into three germ layers.
Conclusions: Our findings emphasize a straightforward method for enhancing the efficiency of canine iPSC generation and provide insight into the Vc effect on the reprogramming process.

Keywords: canine induced pluripotent stem cells, induced pluripotent stem cells, reprogramming, vitamin C

Pluripotent stem cells, including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), have the capacity to self-renew indefinitely and develop into all of the somatic cell lineages (Thomson et al., 1998; Takahashi et al., 2007). For these reasons, pluripotent stem cells are able to act as an effective basis for the development of new therapies in the fields of regenerative medicine, disease modeling, and pharmaceuticals. The first iPSCs were generated in 2006 by ectopic expression of four transcription factors found in abundance in embryonic stem cells: Yamanska’s factor, Oct4, Sox2, Klf4, and c-Myc (OSKM) (Takahashi and Yamanaka, 2006). For it to successfully generate iPSCs, it is necessary to simultaneously downregulate somatic genes and upregulate pluripotent genes. The transition to a more permissive state of chromatin remodeling is essential for facilitating dynamic alterations in gene expression. However, the presence of partially reprogrammed cells during somatic cell reprogramming as a result of aberrant epigenetic modification may contribute to a decrease in reprogramming efficiency (Chan et al., 2009; Kim et al., 2014). Even though these pre-iPSCs have ESC-like morphology, they are unable to express core pluripotency-related genes such as Nanog, Rex1, and Dppa5, and their exogenous transgenes that are delivered into somatic cells are not muted (Hochedlinger and Plath, 2009). As mouse iPSCs were initially developed, subsequent studies have demonstrated the successful creation of iPSCs in multiple species, including humans, monkeys, rats, and pigs (Yu et al., 2007; Liu et al., 2008; Esteban et al., 2009; Liao et al., 2009).

Dogs are acknowledged as human companions and family members who are profoundly involved in human activity and socializing. Therefore, veterinary medicine needs sophisticated medical care, such as regenerative medicine employing canine pluripotent stem cells (Betts and Tobias, 2015). Furthermore, because canines share the same environments as humans, they are susceptible to the same diseases. In addition, canines have a long life expectancy, so their therapeutic efficacy and safety can be evaluated over an extended period of time (Starkey et al., 2005). Due to the high similarity in physiological and biochemical characteristics, the dog has been used for many years as a model for human diseases (Ostrander et al., 2000; Schneider et al., 2008). Consequently, using canine pluripotent stem cells would provide a novel large animal preclinical model for human regenerative medicine and aid our understanding of the underlying mechanisms (Betts and Tobias, 2015). Canine iPSCs have been reported to be created in a number of prior research (Lee et al., 2011; Whitworth et al., 2012; Koh et al., 2013; Baird et al., 2015; Gonçalves et al., 2017). In this research, we aimed to successfully derive iPSCs from canine fetal fibroblasts (CFFs).

Fibroblasts and other somatic cells age rapidly in culture, due in part to the accumulation of reactive oxygen species (ROS) generated during cell metabolism (Parrinello et al., 2003). Vitamin C (Vc), also known as L-ascorbic acid, is an effective antioxidant and plays a vital role in numerous enzymatic reactions. It has been discovered that Vc treatment increases the developmental competence of embryos in numerous species due to its antioxidant effect (Kere et al., 2013). Vc treatment of iPSCs enhanced the efficiency of somatic cell reprogramming in mouse and human trials, possibly by reducing cellular senescence (Esteban et al., 2010). By reducing cell senescence, Vc significantly enhances the formation of iPSC colonies. Vc can convert pre-iPSCs into entirely reprogrammed cells by preventing the Dlk1-Dio3 imprinting defect (Xu et al., 2015). In this investigation, we aimed to figure out the effect of Vc on the reprogramming of canine iPSCs. Furthermore, pluripotency and differentiation potential were assessed to evaluate the properties of canine iPSCs treated with Vc.

Cells

The CFFs were generously given by Professor Min-Kyu Kim from Chungnam National University. Mouse embryonic fibroblasts (MEFs) were employed as feeder cells. CFFs and MEFs were grown in Dulbecco’s modified Eagle’s medium (DMEM; Hyclone, Logan, UT, USA) containing 10% (v/v) fetal bovine serum (FBS; Hyclone), 1% (v/v) penicillin-streptomycin (Gibco, Grand Island, NY, USA) and 0.1 mM nonessential amino acids (NEAA; Sigma, St. Louis, MO, USA). MEFs were treated with mitomycin C (MMC) for two hours, and then MMC was rendered inactive prior to their use as feeder layers. MEFs from passage 4 and earlier were co-cultured with canine iPSCs. The Platinum-A Retroviral Packaging Cell Line (Plat-A; Cell Biolabs, San Diego, CA, USA) was maintained in identical culture media. The cells were incubated at 37℃ in a humidified atmosphere containing 5% CO2.

For Vc supplementation, 50 g/mL of Vc (Sigma) was used. In addition, 1 mM Valproic acid (Sigma) was added prior to the initial mechanical passaging. After mechanical isolation with a pulled Pasteur pipette, colonies were subcultured onto fresh feeder layers every 5-7 days.

Generation of canine iPSCs

For retroviral transduction, PLAT-A cells were inoculated one day prior to transfection. The following day, PLAT-A cells were transfected with pMXs retroviral vectors containing human OCT4, SOX2, KLF4, C-MYC, and GFP. FuGENE6 (Promega, WI, USA) was used in accordance with the manufacturer’s instructions to perform the transfection. Following 48 hours, the viral supernatants were collected and filtered through a 0.45 µm filter. The filtered supernatants were either used to infect cFFs supplemented with protamine sulfate (Sigma) and bFGF (Peprotech, Rocky Hill, NJ, USA) or frozen at -80℃ until use.

For canine iPSCs generation, CFFs at early passages were transduced with pMX-based vectors that encode human Oct4, Sox2, Klf4, c-Myc, and GFP. After transduction of human OSKM, infected CFFs were cultured on feeder layers in KnockOut DMEM (Gibco) supplemented with 20% (v/v) knockout serum replacement (KSR; Gibco), 1% (v/v) penicillin-streptomycin (Gibco), 0.1 mM NEAA (Sigma), 10 ng/mL human leukemia inhibitory factor (hLIF; BioVision, CA, USA), 10 ng/mL basic fibroblast growth factor (bFGF, Peprotech), 0.5 µM MEK inhibitor PD0325901 (BioVision) and 3 µM GSK3β inhibitor CHIR99021 (BioVision).

AP staining and immunocytochemistry

For alkaline phosphatase (AP) staining, cells were fixed for 30 seconds in a 10% (v/v) formaldehyde solution in Dulbecco’s Phosphate Buffered Saline (DPBS) and then rinsed with DPBS at room temperature. Following manufacturer instructions, BCIP/NBT Liquid Substrate System (Sigma) was used to stain fixed cells.

For immunocytochemistry, colonies were fixed with 10% (v/v) formaldehyde solution in DPBS for 30 minutes at room temperature and then blocked for 2 hours with DPBS containing 0.3% Triton X-100 (Sigma) and 5% FBS (Hyclone). The primary antibody binding was conducted overnight at 4℃. After rinsing with DPBS, colonies were incubated for 2 hours at room temperature with a fluorescence-conjugated secondary antibody. Immunocytochemistry utilizes the following primary antibodies: rabbit anti-Oct3/4 (SC-9081, SantaCruz), rabbit anti-Sox2 (AB5603, Millipore), rabbit anti-Nanog (SC-33759, SantaCruz), and rabbit anti-TRA-1-60 (MAB4360, Millipore). As a secondary antibody, FITC-labeled anti-rabbit IgG was used. With Hoechst 33342, nuclei were stained. Utilizing a fluorescence microscope (Nikon, Tokyo, Japan), the colonies were observed.

Carboxyfluorescein succinimidyl ester (CFSE) assay

To assess proliferative ability, a CFSE assay was performed by utilizing CellTrace Cell Proliferation Kits (Life Technologies, Carlsbad, CA, USA). CFFs transduced with OSKM were harvested and CFSE-labeled per the manufacturer’s instructions. At 72 h, the proliferation of CFSE-labeled cells was confirmed by flow cytometry and analyzed by Flow Jo software (https://www.flowjo.com).

Polymerase chain reaction (PCR)

Total RNA was extracted from the cells using TRIzol reagent (Invitrogen, CA, USA). cDNA was synthesized using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA) according to the manufacturer’s instructions. PCR was performed using EX Taq polymerase (Takara, Japan) and the following cycle parameters were used: denaturation at 95℃ for 5 min; amplification for 35 cycles with melting at 95℃ for 30 s, annealing at 60℃ for 1 min, and extension at 72℃ for 1 min; followed by a final extension at 72℃ for 5 min. Real-time quantitative PCR (qPCR) was performed using SYBR premix Ex Taq (Takara, Otsu, Japan) according to the manufacturer’s instruction on the ABI 7500 Real-time PCR Instrument system (Applied Biosystems, Waltham, MA, USA). Quantification of relative gene expression levels was calculated using the 2-ΔΔCt method and Gapdh was used as an endogenous control. The primers used in this research are listed in Table 1.

Table 1 . The primers employed in this study

GenePrimer sequence (5’ to 3’)Accession number
Canine GapdhTATCAGTTGTGGATCTGACCTG
GCGTCGAAGGTGGAAGAGT
NM_001003142.2
Canine Oct4TCGTGAAGCCGGACAAGGAGAAG
AGGAACATGTTCTCCAGGTTGCCT
XM_038553312.1
Canine Sox2ATGTACAACATGATGGAGACGGAGCTG
TCACATGTGCGAGAGGGGCAGT
XM_038583467.1
Canine Rex1GAGAAGCATCTCCTCGTCCA
GCGTTTCCCACATCCTTCAA
XM_038559236.1
Canine NanogCCAAGCACCCAACTCTAGGG
GGGTCGCATCTTCCTTCCTCGC
LC672615.1
Canine telomeraseTGCGTCTGGTACACAATCACGTC
TGACCAGCAGGAAGTCGTCCACCA
NM_001031630.2
Canine NkxCCAAGGACCCTCGAGCTGA
CGACAGATACCGCTGCTGCT
NM_001010959.3
Canine Cxcr4ACTCCATGAAGGAACCCTGCTT
TGCCCACTATGCCAGTCAAGA
NM_001048026.1
Canine βIIItubulinCCGGAACCATGGACAGCGTC
AGCGGAGAGAAGTAGTGACG
XM_005620536.3
Human Oct4GTAGACGGCATCGCAGCTTG
AGCCAGGTCCGAGGATCAAC
OK304863.1
Human Sox2GTAGACGGCATCGCAGCTTG
TCCGGGCTGTTTTTCTGGTT
NM_003106.4
Human Klf4GTAGACGGCATCGCAGCTTG
CGCGAACGTGGAGAAAGATG
NM_001314052.2
Human c-MycGTAGACGGCATCGCAGCTTG
GAAATACGGCTGCACCGAGTC
NM_002467.6


Karyotyping

In T flasks (Corning), cells were grown sparsely and treated with colcemid (Gibco) at a final concentration of 50 µg/mL for one hour. The cells were trypsinized, centrifuged at 2,000 g for 5 minutes, resuspended in 8 mL of 0.075 M KCl (Sigma), and incubated at 37℃ for 25 minutes. A fixative solution consisting of 1 part acetic acid (Sigma) and 3 parts methanol (Sigma) was added to a final volume of 10 mL, delicately mixed, and incubated at -20℃ for 30 minutes. After centrifugation, the supernatant was removed, and a final volume of 10 mL of cold fixative solution (Invitrogen) was added to cleanse the cell suspension. This stage must be repeated three times. After the final centrifugation, the pelleted cells should be suspended in a small volume of fixative solution. Allow the cell suspension to dry at 90℃ for one hour after being placed on a cold-wet slide. The slides were treated with trypsin and stained with Giemsa staining solution (Sigma). For chromosome analysis, slides were analyzed under an optical microscope (Nikon, Tokyo, Japan).

Embryonic body (EB) formation and in vitro differentiation

Colonies of canine iPSCs were separated mechanically to eliminate differentiated cells and the feeder layer. They were cut into tiny pieces with a glass pipette and plated on petri dishes containing the in KnockOut DMEM (Gibco) supplemented with 20% (v/v) KSR (Gibco), 1% (v/v) penicillin-streptomycin (Gibco), 0.1 mM NEAA (Sigma). After five days, EBs were transferred to dishes coated with 0.1% gelatin. The EBs on the plate spontaneously differentiated for a minimum of three weeks. Every two days, a portion of the EB formation and differentiation medium was replaced.

Statistical analysis

The data were obtained from at least three independent experiments and presented as the mean ± standard error of the mean (SEM). All experimental results were statistically analyzed using SPSS 22.0 (SPSS Inc., Chicago, IL, USA). A t-test was used to assess statistical significance. A p-value below 0.05 was deemed statistically significant (*p < 0.05; **p < 0.01).

Vitamin C promotes reprogramming of canine fibroblasts

For the generation of canine iPSCs, retroviruses containing Yamanaka’s factors (Oct4, Sox2, Klf4, c-Myc; OSKM) and GFP were transduced into CFFs (Fig. 1A). Following two rounds of transduction with OSKM, the culture medium was subsequently transitioned to ESC medium containing Vc in order to investigate the impact of Vc on the reprogramming activity. During the initial phase of reprogramming, there were no notable variations in morphology observed between the cells treated with Vc and the control group (data not shown). Nevertheless, following a culture period of 10 days, it was noticed that the Vc-treated group exhibited a higher number of AP-positive colonies (Fig. 1B). The colonies were categorized into three distinct groups based on their respective sizes. The classification of colonies is as follows: colonies with a diameter exceeding 0.8 mm are categorized as group A, colonies with a diameter ranging from 0.25 to 0.8 mm are classified as group B, and colonies with a diameter less than 0.25 mm fall under group C (Fig. 1C). The results obtained from groups A, B, and C collectively demonstrated that the application of Vc treatment led to a higher number of AP positive colonies being produced. The middle-sized group B, which exhibited a preferable colony size for mechanical passaging, demonstrated notable distinctions. Based on the results obtained from this work, it was shown that the reprogramming of CFFs into iPSCs was significantly enhanced with the application of Vc treatment.

Figure 1. Vitamin C enhances the reprogramming of canine fetal fibroblasts (CFFs). (A) A schematic diagram illustrating the process of generating canine induced pluripotent stem cells (iPSCs). CFFs were transduced with Yamanaka’s factors (Oct4, Sox2, Klf4, c-Myc; OSKM) and GFP. At day 5, infected cells were split on feeders during the gradual transition to ES media, vitamin C (Vc) was or was not administered (Vc treated or control). (B) AP staining of untreated or Vc-treated infected CFFs. (C) Number of AP-positive colonies in three size-classified groups. Group A (0.8 mm-), Group B (0.25-0.8 mm), Group C (~0.25 mm). Mean ± SEM of five independent experiments are shown (*p < 0.05).

Vitamin C has an effect on the reprogramming process

To determine how Vc improves the efficiency of canine iPSC generation, the observation of GFP expression was conducted in both Vc-treated and untreated infected cells to validate the effective transduction of OSKM. The Vc-treated group displayed a greater number of GFP-positive cells than the control group after being transferred to the feeder layer and supplemented with Vc (Fig. 2A). This observation suggests that the treatment with Vc improves the efficacy of OSKM transduction using retroviruses. We then assessed the proliferation ability of the cells treated with Vc by CFSE assay. It was observed that the group treated with Vc exhibited a decreased mean fluorescence intensity, indicating an increased proliferation ability (Fig. 2B). Subsequently, so as to figure out the impact of Vc treatment on enhancing reprogramming efficiency, we assessed the endogenous gene expression of Oct4 following to infection. Consequently, it was shown that the expression level of endogenous Oct4 was significantly elevated upon treatment with Vc (Fig. 2C).

Figure 2. The early phase of cellular reprogramming is affected by vitamin C. (A) GFP expression depending on whether vitamin C (Vc) is treated or not. (B) CFSE assay in infected cells treated with Vc or not. The black histogram represents the Vc treated group, while the gray histogram represents the control group. (C) Expression of the canine Oct4 gene in infected cells treated with or without Vc. qPCR was used to examine Oct4 gene expression at 0 h, 24 h, and 72 h post-infection. Data are presented as meanSEM (*p < 0.05, **p < 0.01) from three replicated experiments.

Characterization was performed on vitamin C-treated canine iPSCs

The characterization of iPSCs derived from CFFs was subsequently examined, as described in the experimental design depicted in Fig. 1A. Following mechanical passaging, the cells displayed a morphology characterized by the formation of compact colonies with well-defined, rounded edges (Fig. 3A), closely similar to the appearance of human and previously reported canine ESCs. To verify the pluripotency of these colonies, which were created from CFFs in the presence of Vc, we conducted an analysis of pluripotency marker expression. The expression of pluripotency markers such as Oct4, Sox2, Nanog, and Tra-1-60 was observed in colonies at passage 5 (Fig. 3B). To verify the pluripotency of Vc-treated canine iPSCs, the endogenous gene expression was evaluated. Canine-specific pluripotency marker genes Oct4, Nanog, Rex1, and Telomerase were expressed in canine iPSCs at passage 5 (Fig. 3C). Particularly, the entire silencing of exogenously transduced human OSKM factors was observed exclusively as they developed in the presence of Vc. (Fig. 3D). Karyotype analysis revealed that these cells had a normal 78, XX karyotype, with 38 matched pairs at passage 5, with no identifiable aneuploidy, tetraploidy, or other structural rearrangements, indicating genomic stability of cells despite their increased cell proliferation under Vc treatment (Fig. 3E).

Figure 3. Canine iPSCs treated with vitamin C were characterized. (A) The morphology of the canine iPSC colonies after treatment with vitamin C (Vc). Colonies were detected in passages 1 and 3 (P1 and P3). Scale bar = 400 μm. (B) Characterization by immunofluorescence of canine iPSCs treated with Vc. The cells were stained with the following pluripotency markers: Oct4, Sox2, Nanog, and Tra-1-60. (C) Characterization by PCR of Vc-treated canine iPSCs. The expression of pluripotent stem cell marker genes (Oct4, Rex1, Nanog, and telomerase) was analyzed. (D) Verification of transgene expression. PCR was used to examine exogenous transgene expression in canine iPSCs treated with or without Vc (+Vc and –Vc). (E) Karyotype analysis in Vc-treated canine iPSCs. Normal: 78, XX with 38 matched pairs of autosomes in cells.

Vitamin C-treated canine iPSCs have the ability to differentiate

To assess the capacity for differentiation in vitro, we induced spontaneous differentiation through the removal of growth factors, resulting in the formation of embryoid bodies (EBs). The colonies were divided mechanically into small fragments, which were then cultured on dishes. After four days, their morphology changed gradually, and they aggregated into round spheres similar to those described in previous reports (Fig. 4A) (Nishimura et al., 2017). On the fifth day of the experiment, the expression of pluripotency markers, including Rex1 and Nanog, was completely suppressed (Fig. 4B). Each EB was then adhered to cell culture substrates and subjected to continuous cultivation after its formation. After a few weeks in culture, these attached cells exhibited heterogeneous cell morphology and increased expression of three germ layer-specific markers, βIII-tubulin, Cxcr4, and Nkx, for the ectoderm, endoderm, and mesoderm, respectively (Fig. 4C). This demonstrated that iPSCs treated with Vc were capable of differentiating in vitro into three germ layers.

Figure 4. Canine iPSCs treated with vitamin C were capable of in vitro differentiation. (A) The Formation of embryonic bodies (EBs) from vitamin C (Vc)-treated canine iPSCs. Above is a picture of floating EBs on day 4, and below is a picture of attached EBs on day 21. Scale bar = 400 μm. (B) Nanog and Rex1 gene expression in canine iPSCs and differentiated embryonic bodies. (C) Expression of three germ layer marker genes in EBs. qPCR was used to examine the expression of βIII-tubulin, Cxcr4, and Nkx in differentiated EBs. Data are presented as mean ± SEM (*p < 0.05) from three replicated experiments.

Stem cells with the ability to differentiate into specialized cells and self-replicate are regarded as novel tools in the field of regenerative medicine (Zakrzewski et al., 2019). Particularly in the case of canines, they have been acknowledged as a representative companion animal and an appropriate model for human disease. Nevertheless, despite the growing demand for canine pluripotent stem cells and recent advances, there are still many hurdles, such as low reprogramming efficiency, incomplete differentiation potential, and defects in exogenous gene silencing (Betts and Tobias, 2015). Slow and ineffective reprogramming is a significant drawback for the production of iPSCs from most species, not just canine stem cells. Here, we demonstrate that CFFs can be reprogrammed into a pluripotent state via the ectopic expression of four transcription factors; human Oct4, Sox2, Klf4, and c-Myc (OSKM) via retroviral transduction, a technique that has been successful in other species. Adding Vc to the culture medium transformed canine somatic cells into iPSCs of superior quality.

Vc treatment during reprogramming increases the formation of putative iPSC colonies by a significant margin. As reported in mice and humans, we examined the rate of AP-positive colony formation treated with Vc in order to determine whether it can facilitate effective reprogramming in canines (Esteban et al., 2010). Despite being AP-positive, the sizes of the colonies differed. As a result, we classified these colonies into three groups based on their size: Group A has recently initiated the process of colony formation, group B has reached a size suitable for mechanical passage, and group C is on the verge of margin differentiation. We observed significant differences in the group B, 10 days after reseeding onto feeder cells, indicating that an increased number of probable colonies can be obtained. These findings indicate that Vc may facilitate the formation of colonies and reprogramming of CFFs.

Upon observing the colony-forming properties of canine iPSCs, we determined that an increased number of cells could be generated via Vc treatment, resulting in the detection of more GFP-positive cells. It suggests that a greater number of infected cells could be produced from the same number of initial cells. Vc enhanced the efficiency of OSKM transduction using retroviruses, as demonstrated by the findings. Given that retroviruses have an exceptional ability to infect cells with a high proliferative capacity, we evaluated the proliferative capacity of the Vc-treated cells using the CFSE assay. After three days of culture, the proliferative capacity of Vc-treated cells was greater than that of untreated cells. This observation suggests that the treatment with Vc enhances the efficacy of retrovirus transduction by enhancing proliferation capacity. Additionally, there was no significant difference in the rate of apoptotic cell death (data not shown). It seems that the observed enhancement in cell proliferation cannot be attributed to variations in cell mortality. The effects of Vc on cell proliferation have been the subject of considerable discussion. In tumor cells, Vc treatment inhibits cell proliferation, which is associated with a cell cycle arrest due to an increase in p53-p21 concentration (Hahm et al., 2007). In contrast, Vc can promote the proliferation of adipose-derived stem cells by inhibiting the p53-p21 pathway (Zhang et al., 2016). In addition, different Vc concentrations and cell types likely result in distinct effects; thus, additional research is required to determine the precise mechanism at work in OSKM-infected CFFs.

Endogenous Oct4 is the core pluripotent gene required for maintaining stemness, and is therefore used as a marker of effective reprogramming. We analyzed the expression of the endogenous Oct4 gene during early reprogramming to further confirm the improved reprogramming efficiency. At 24 h and 72 h after transfer to the feeder layer, cells treated with Vc exhibited a dramatic increase in Oct4 expression, whereas cells in the control group exhibited a delayed increase. Comparing each condition at 24 h and 72 h, cells treated with Vc exhibited significantly higher expression levels. According to these findings, Vc treatment increases infection rate by promoting cell proliferation and accelerates the expression of the endogenous core pluripotent gene, thereby enhancing early reprogramming efficiency.

Infected CFFs that were supplemented with Vc successfully formed flat, densely packed cells with rounded margins, similar to previously reported primed state stem cell morphology (Lee et al., 2011; Whitworth et al., 2012; Koh et al., 2013; Baird et al., 2015; Gonçalves et al., 2017). Additionally, we confirmed that canine iPSCs expressed pluripotent surface markers and endogenous pluripotent genes. Vc-treated canine iPSCs suppress four exogenous transcription factors after three passages, whereas untreated control cells continue to express OSKM ectopically. Since the effective silencing of exogenous reprogramming factors has been regarded as evidence of a complete reprogramming (Hotta and Ellis, 2008), we suppose that Vc could aid in obtaining reprogrammed cells of higher quality. Vc have been shown to be efficacious in converting pre-iPSCs to iPSCs in a previous report (Esteban et al., 2010). Vc accelerated transcriptome changes during reprogramming and may have promoted epigenetic modifications that permit additional change. In order to determine the precise function of Vc in epigenetic modification, additional research is required.

In this study, Vc treatment facilitates efficient reprogramming and generates canine iPSCs of superior quality. We demonstrated that Vc treatment during somatic cell reprogramming in canines promotes cell proliferation and retrovirus transduction. Consequently, exogenous reprogramming factors were efficiently silenced, and the induction of endogenous pluripotent genes was accelerated in the Vc-treated group.

This study was supported by 2023 the RDA Fellowship Program of National Institute of Animal Science, Rural Development Administration, Republic of Korea.

Conceptualization, J.S.L., J.H.H.; methodology, J.S.L., S.E.K.; investigation, J.S.L., S.E.K.; data curation, S.E.K.; writing—original draft preparation, J.S.L., S.E.K.; writing—review and editing, K.B.O., J.H.H.; supervision, J.H.H.; project administration, J.H.H.; funding acquisition, J.H.H.

This work was supported by the National Research Council of Science & Technology (NST) granted by the Korea government (MIST) (grant no. CRC21021).

  1. Baird A, Guest DJ. 2015. Derivation of canine induced pluripotent stem cells. Reprod. Domest. Anim. 50:669-676.
    Pubmed CrossRef
  2. Betts DH and Tobias IC. 2015. Canine pluripotent stem cells: are they ready for clinical applications? Front. Vet. Sci. 2:41.
    Pubmed KoreaMed CrossRef
  3. Chan EM, Ratanasirintrawoot S, Park IH, Manos PD, Loh YH, Huo H, Miller JD, Hartung O, Rho J, Ince TA, Schlaeger TM. 2009. Live cell imaging distinguishes bona fide human iPS cells from partially reprogrammed cells. Nat. Biotechnol. 27:1033-1037.
    Pubmed CrossRef
  4. Esteban MA, Wang T, Qin B, Yang J, Qin D, Cai J, Li W, Weng Z, Chen J, Ni S, Chen K, Li Y, Liu X, Xu J, Zhang S, Li F, He W, Labuda K, Song Y, Peterbauer A, Wolbank S, Redl H, Zhong M, Cai D, Pei D. 2010. Vitamin C enhances the generation of mouse and human induced pluripotent stem cells. Cell Stem Cell 6:71-79.
    Pubmed CrossRef
  5. Esteban MA, Xu J, Yang J, Peng M, Qin D, Li W, Jiang Z, Chen J, Deng K, Zhong M, Cai J, Pei D. 2009. Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J. Biol. Chem. 284:17634-17640.
    Pubmed KoreaMed CrossRef
  6. Gonçalves NJN, Bressan FF, Roballo KCS, Meirelles FV, Xavier PLP, Fukumasu H, Williams C, Breen M, Koh S, Sper R, Ambrósio CE. 2017. Generation of LIF-independent induced pluripotent stem cells from canine fetal fibroblasts. Theriogenology 92:75-82.
    Pubmed CrossRef
  7. Hahm E, Jin DH, Kang JS, Kim YI, Hong SW, Lee SK, Kim HN, Jung DJ, Kim JE, Shin DH, Hwang YI, Kim YS, Hur DY, Yang Y, Cho D, Lee WJ. 2007. The molecular mechanisms of vitamin C on cell cycle regulation in B16F10 murine melanoma. J. Cell. Biochem. 102:1002-1010.
    Pubmed CrossRef
  8. Hochedlinger K and Plath K. 2009. Epigenetic reprogramming and induced pluripotency. Development 136:509-523.
    Pubmed KoreaMed CrossRef
  9. Hotta A and Ellis J. 2008. Retroviral vector silencing during iPS cell induction: an epigenetic beacon that signals distinct pluripotent states. J. Cell. Biochem. 105:940-948.
    Pubmed CrossRef
  10. Kere M, Siriboon C, Lo NW, Ju JC. 2013. Ascorbic acid improves the developmental competence of porcine oocytes after parthenogenetic activation and somatic cell nuclear transplantation. J. Reprod. Dev. 59:78-84.
    Pubmed KoreaMed CrossRef
  11. Kim JS, Choi HW, Choi S, Seo HG, Moon SH, Do JT. 2014. Conversion of partially reprogrammed cells to fully pluripotent stem cells is associated with further activation of stem cell maintenance- and gamete generation-related genes. Stem Cells Dev. 23:2637-2648.
    Pubmed KoreaMed CrossRef
  12. Koh S, Thomas R, Tsai S, Bischoff S, Lim JH, Breen M, Piedrahita JA. 2013. Growth requirements and chromosomal instability of induced pluripotent stem cells generated from adult canine fibroblasts. Stem Cells Dev. 22:951-963.
    Pubmed KoreaMed CrossRef
  13. Lee AS, Xu D, Plews JR, Nguyen PK, Nag D, Lyons JK, Han L, Hu S, Lan F, Liu J, Huang M, Narsinh KH, Long CT, de Almeida PE, Levi B, Kooreman N, Bangs C, Pacharinsak C, Ikeno F, Yeung AC, Gambhir SS, Robbins RC, Wu JC. 2011. Preclinical derivation and imaging of autologously transplanted canine induced pluripotent stem cells. J. Biol. Chem. 286:32697-32704.
    Pubmed KoreaMed CrossRef
  14. Liao J, Cui C, Chen S, Ren J, Chen J, Gao Y, Li H, Jia N, Cheng L, Xiao L. 2009. Generation of induced pluripotent stem cell lines from adult rat cells. Cell Stem Cell 4:11-15.
    Pubmed CrossRef
  15. Liu H, Zhu F, Yong J, Zhang P, Hou P, Li H, Jiang W, Cai J, Liu M, Cui K, Qu X, Xiang T, Lu D, Chi X, Gao G, Ji W, Deng H. 2008. Generation of induced pluripotent stem cells from adult rhesus monkey fibroblasts. Cell Stem Cell 3:587-590.
    Pubmed CrossRef
  16. Nishimura T, Hatoya S, Kanegi R, Wijesekera DPH, Sanno K, Tanaka E, Sugiura K, Hiromitsu Tamada NK, Inaba T. 2017. Feeder-independent canine induced pluripotent stem cells maintained under serum-free conditions. Mol. Reprod. Dev. 84:329-339.
    Pubmed CrossRef
  17. Ostrander EA, Patterson DF. 2000. Canine genetics comes of age. Trends Genet. 16:117-124.
    Pubmed CrossRef
  18. Parrinello S, Samper E, Krtolica A, Goldstein J, Campisi J. 2003. Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat. Cell Biol. 5:741-747.
    Pubmed KoreaMed CrossRef
  19. Schneider MR, Wolf E, Braun J, Adler H. 2008. Canine embryo-derived stem cells and models for human diseases. Hum. Mol. Genet. 17(R1):R42-R47.
    Pubmed CrossRef
  20. Starkey MP, Scase TJ, Murphy S. 2005. Dogs really are man's best friend--canine genomics has applications in veterinary and human medicine! Brief. Funct. Genomic. Proteomic. 4:112-128.
    Pubmed CrossRef
  21. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Yamanaka S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861-872.
    Pubmed CrossRef
  22. Takahashi K and Yamanaka S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676.
    Pubmed CrossRef
  23. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Jones JM. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145-1147.
    Pubmed CrossRef
  24. Whitworth DJ, Wolvetang EJ. 2012. Generation and characterization of LIF-dependent canine induced pluripotent stem cells from adult dermal fibroblasts. Stem Cells Dev. 21:2288-2297.
    Pubmed CrossRef
  25. Xu X, Smorag L, Nakamura T, Kimura T, Dressel R, Fitzner A, Tan X, Linke M, Zechner U, Pantakani DV. 2015. Dppa3 expression is critical for generation of fully reprogrammed iPS cells and maintenance of Dlk1-Dio3 imprinting. Nat. Commun. 6:6008.
    Pubmed KoreaMed CrossRef
  26. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Thomson JA. 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science 318:1917-1920.
    Pubmed CrossRef
  27. Zakrzewski W, Dobrzyński M, Rybak Z. 2019. Stem cells: past, present, and future. Stem Cell Res. Ther. 10:68.
    Pubmed KoreaMed CrossRef
  28. Zhang P, Li J, Qi Y, Zou Y, Liu L, Tang X, Duan J, Zeng G. 2016. Vitamin C promotes the proliferation of human adipose-derived stem cells via p53-p21 pathway. Organogenesis 12:143-151.
    Pubmed KoreaMed CrossRef

Article

Original Article

Journal of Animal Reproduction and Biotechnology 2023; 38(4): 199-208

Published online December 31, 2023 https://doi.org/10.12750/JARB.38.4.199

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Vitamin C promotes the early reprogramming of fetal canine fibroblasts into induced pluripotent stem cells

Sang Eun Kim1,2,# , Jun Sung Lee1,# , Keon Bong Oh2 and Jeong Ho Hwang3,*

1Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 05020, Korea
2Animal Biotechnology Division, National Institute of Animal Science, Rural Development Administration, Wanju 55365, Korea
3Animal Model Research Group, Jeonbuk Branch, Korea Institute of Toxicology, Jeongeup 56212, Korea

Correspondence to:Jeong Ho Hwang
E-mail: jeongho.hwang@kitox.re.kr

#These authors contributed equally to this work.

Received: September 15, 2023; Revised: October 27, 2023; Accepted: November 7, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background: Canine induced pluripotent stem cells (iPSCs) are an attractive source for veterinary regenerative medicine, disease modeling, and drug development. Here we used vitamin C (Vc) to improve the reprogramming efficiency of canine iPSCs, and its functions in the reprogramming process were elucidated.
Methods: Retroviral transduction of Oct4, Sox2, Klf4, c-Myc (OSKM), and GFP was employed to induce reprogramming in canine fetal fibroblasts. Following transduction, the culture medium was subsequently replaced with ESC medium containing Vc to determine the effect on reprogramming activity.
Results: The number of AP-positive iPSC colonies dramatically increased in culture conditions supplemented with Vc. Vc enhanced the efficacy of retrovirus transduction, which appears to be correlated with enhanced cell proliferation capacity. To confirm the characteristics of the Vc-treated iPSCs, the cells were cultured to passage 5, and pluripotency markers including Oct4, Sox2, Nanog, and Tra-1-60 were observed by immunocytochemistry. The expression of endogenous pluripotent genes (Oct4, Nanog, Rex1, and telomerase) were also verified by PCR. The complete silencing of exogenously transduced human OSKM factors was observed exclusively in canine iPSCs treated with Vc. Canine iPSCs treated with Vc are capable of forming embryoid bodies in vitro and have spontaneously differentiated into three germ layers.
Conclusions: Our findings emphasize a straightforward method for enhancing the efficiency of canine iPSC generation and provide insight into the Vc effect on the reprogramming process.

Keywords: canine induced pluripotent stem cells, induced pluripotent stem cells, reprogramming, vitamin C

INTRODUCTION

Pluripotent stem cells, including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), have the capacity to self-renew indefinitely and develop into all of the somatic cell lineages (Thomson et al., 1998; Takahashi et al., 2007). For these reasons, pluripotent stem cells are able to act as an effective basis for the development of new therapies in the fields of regenerative medicine, disease modeling, and pharmaceuticals. The first iPSCs were generated in 2006 by ectopic expression of four transcription factors found in abundance in embryonic stem cells: Yamanska’s factor, Oct4, Sox2, Klf4, and c-Myc (OSKM) (Takahashi and Yamanaka, 2006). For it to successfully generate iPSCs, it is necessary to simultaneously downregulate somatic genes and upregulate pluripotent genes. The transition to a more permissive state of chromatin remodeling is essential for facilitating dynamic alterations in gene expression. However, the presence of partially reprogrammed cells during somatic cell reprogramming as a result of aberrant epigenetic modification may contribute to a decrease in reprogramming efficiency (Chan et al., 2009; Kim et al., 2014). Even though these pre-iPSCs have ESC-like morphology, they are unable to express core pluripotency-related genes such as Nanog, Rex1, and Dppa5, and their exogenous transgenes that are delivered into somatic cells are not muted (Hochedlinger and Plath, 2009). As mouse iPSCs were initially developed, subsequent studies have demonstrated the successful creation of iPSCs in multiple species, including humans, monkeys, rats, and pigs (Yu et al., 2007; Liu et al., 2008; Esteban et al., 2009; Liao et al., 2009).

Dogs are acknowledged as human companions and family members who are profoundly involved in human activity and socializing. Therefore, veterinary medicine needs sophisticated medical care, such as regenerative medicine employing canine pluripotent stem cells (Betts and Tobias, 2015). Furthermore, because canines share the same environments as humans, they are susceptible to the same diseases. In addition, canines have a long life expectancy, so their therapeutic efficacy and safety can be evaluated over an extended period of time (Starkey et al., 2005). Due to the high similarity in physiological and biochemical characteristics, the dog has been used for many years as a model for human diseases (Ostrander et al., 2000; Schneider et al., 2008). Consequently, using canine pluripotent stem cells would provide a novel large animal preclinical model for human regenerative medicine and aid our understanding of the underlying mechanisms (Betts and Tobias, 2015). Canine iPSCs have been reported to be created in a number of prior research (Lee et al., 2011; Whitworth et al., 2012; Koh et al., 2013; Baird et al., 2015; Gonçalves et al., 2017). In this research, we aimed to successfully derive iPSCs from canine fetal fibroblasts (CFFs).

Fibroblasts and other somatic cells age rapidly in culture, due in part to the accumulation of reactive oxygen species (ROS) generated during cell metabolism (Parrinello et al., 2003). Vitamin C (Vc), also known as L-ascorbic acid, is an effective antioxidant and plays a vital role in numerous enzymatic reactions. It has been discovered that Vc treatment increases the developmental competence of embryos in numerous species due to its antioxidant effect (Kere et al., 2013). Vc treatment of iPSCs enhanced the efficiency of somatic cell reprogramming in mouse and human trials, possibly by reducing cellular senescence (Esteban et al., 2010). By reducing cell senescence, Vc significantly enhances the formation of iPSC colonies. Vc can convert pre-iPSCs into entirely reprogrammed cells by preventing the Dlk1-Dio3 imprinting defect (Xu et al., 2015). In this investigation, we aimed to figure out the effect of Vc on the reprogramming of canine iPSCs. Furthermore, pluripotency and differentiation potential were assessed to evaluate the properties of canine iPSCs treated with Vc.

MATERIALS AND METHODS

Cells

The CFFs were generously given by Professor Min-Kyu Kim from Chungnam National University. Mouse embryonic fibroblasts (MEFs) were employed as feeder cells. CFFs and MEFs were grown in Dulbecco’s modified Eagle’s medium (DMEM; Hyclone, Logan, UT, USA) containing 10% (v/v) fetal bovine serum (FBS; Hyclone), 1% (v/v) penicillin-streptomycin (Gibco, Grand Island, NY, USA) and 0.1 mM nonessential amino acids (NEAA; Sigma, St. Louis, MO, USA). MEFs were treated with mitomycin C (MMC) for two hours, and then MMC was rendered inactive prior to their use as feeder layers. MEFs from passage 4 and earlier were co-cultured with canine iPSCs. The Platinum-A Retroviral Packaging Cell Line (Plat-A; Cell Biolabs, San Diego, CA, USA) was maintained in identical culture media. The cells were incubated at 37℃ in a humidified atmosphere containing 5% CO2.

For Vc supplementation, 50 g/mL of Vc (Sigma) was used. In addition, 1 mM Valproic acid (Sigma) was added prior to the initial mechanical passaging. After mechanical isolation with a pulled Pasteur pipette, colonies were subcultured onto fresh feeder layers every 5-7 days.

Generation of canine iPSCs

For retroviral transduction, PLAT-A cells were inoculated one day prior to transfection. The following day, PLAT-A cells were transfected with pMXs retroviral vectors containing human OCT4, SOX2, KLF4, C-MYC, and GFP. FuGENE6 (Promega, WI, USA) was used in accordance with the manufacturer’s instructions to perform the transfection. Following 48 hours, the viral supernatants were collected and filtered through a 0.45 µm filter. The filtered supernatants were either used to infect cFFs supplemented with protamine sulfate (Sigma) and bFGF (Peprotech, Rocky Hill, NJ, USA) or frozen at -80℃ until use.

For canine iPSCs generation, CFFs at early passages were transduced with pMX-based vectors that encode human Oct4, Sox2, Klf4, c-Myc, and GFP. After transduction of human OSKM, infected CFFs were cultured on feeder layers in KnockOut DMEM (Gibco) supplemented with 20% (v/v) knockout serum replacement (KSR; Gibco), 1% (v/v) penicillin-streptomycin (Gibco), 0.1 mM NEAA (Sigma), 10 ng/mL human leukemia inhibitory factor (hLIF; BioVision, CA, USA), 10 ng/mL basic fibroblast growth factor (bFGF, Peprotech), 0.5 µM MEK inhibitor PD0325901 (BioVision) and 3 µM GSK3β inhibitor CHIR99021 (BioVision).

AP staining and immunocytochemistry

For alkaline phosphatase (AP) staining, cells were fixed for 30 seconds in a 10% (v/v) formaldehyde solution in Dulbecco’s Phosphate Buffered Saline (DPBS) and then rinsed with DPBS at room temperature. Following manufacturer instructions, BCIP/NBT Liquid Substrate System (Sigma) was used to stain fixed cells.

For immunocytochemistry, colonies were fixed with 10% (v/v) formaldehyde solution in DPBS for 30 minutes at room temperature and then blocked for 2 hours with DPBS containing 0.3% Triton X-100 (Sigma) and 5% FBS (Hyclone). The primary antibody binding was conducted overnight at 4℃. After rinsing with DPBS, colonies were incubated for 2 hours at room temperature with a fluorescence-conjugated secondary antibody. Immunocytochemistry utilizes the following primary antibodies: rabbit anti-Oct3/4 (SC-9081, SantaCruz), rabbit anti-Sox2 (AB5603, Millipore), rabbit anti-Nanog (SC-33759, SantaCruz), and rabbit anti-TRA-1-60 (MAB4360, Millipore). As a secondary antibody, FITC-labeled anti-rabbit IgG was used. With Hoechst 33342, nuclei were stained. Utilizing a fluorescence microscope (Nikon, Tokyo, Japan), the colonies were observed.

Carboxyfluorescein succinimidyl ester (CFSE) assay

To assess proliferative ability, a CFSE assay was performed by utilizing CellTrace Cell Proliferation Kits (Life Technologies, Carlsbad, CA, USA). CFFs transduced with OSKM were harvested and CFSE-labeled per the manufacturer’s instructions. At 72 h, the proliferation of CFSE-labeled cells was confirmed by flow cytometry and analyzed by Flow Jo software (https://www.flowjo.com).

Polymerase chain reaction (PCR)

Total RNA was extracted from the cells using TRIzol reagent (Invitrogen, CA, USA). cDNA was synthesized using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA) according to the manufacturer’s instructions. PCR was performed using EX Taq polymerase (Takara, Japan) and the following cycle parameters were used: denaturation at 95℃ for 5 min; amplification for 35 cycles with melting at 95℃ for 30 s, annealing at 60℃ for 1 min, and extension at 72℃ for 1 min; followed by a final extension at 72℃ for 5 min. Real-time quantitative PCR (qPCR) was performed using SYBR premix Ex Taq (Takara, Otsu, Japan) according to the manufacturer’s instruction on the ABI 7500 Real-time PCR Instrument system (Applied Biosystems, Waltham, MA, USA). Quantification of relative gene expression levels was calculated using the 2-ΔΔCt method and Gapdh was used as an endogenous control. The primers used in this research are listed in Table 1.

Table 1. The primers employed in this study.

GenePrimer sequence (5’ to 3’)Accession number
Canine GapdhTATCAGTTGTGGATCTGACCTG
GCGTCGAAGGTGGAAGAGT
NM_001003142.2
Canine Oct4TCGTGAAGCCGGACAAGGAGAAG
AGGAACATGTTCTCCAGGTTGCCT
XM_038553312.1
Canine Sox2ATGTACAACATGATGGAGACGGAGCTG
TCACATGTGCGAGAGGGGCAGT
XM_038583467.1
Canine Rex1GAGAAGCATCTCCTCGTCCA
GCGTTTCCCACATCCTTCAA
XM_038559236.1
Canine NanogCCAAGCACCCAACTCTAGGG
GGGTCGCATCTTCCTTCCTCGC
LC672615.1
Canine telomeraseTGCGTCTGGTACACAATCACGTC
TGACCAGCAGGAAGTCGTCCACCA
NM_001031630.2
Canine NkxCCAAGGACCCTCGAGCTGA
CGACAGATACCGCTGCTGCT
NM_001010959.3
Canine Cxcr4ACTCCATGAAGGAACCCTGCTT
TGCCCACTATGCCAGTCAAGA
NM_001048026.1
Canine βIIItubulinCCGGAACCATGGACAGCGTC
AGCGGAGAGAAGTAGTGACG
XM_005620536.3
Human Oct4GTAGACGGCATCGCAGCTTG
AGCCAGGTCCGAGGATCAAC
OK304863.1
Human Sox2GTAGACGGCATCGCAGCTTG
TCCGGGCTGTTTTTCTGGTT
NM_003106.4
Human Klf4GTAGACGGCATCGCAGCTTG
CGCGAACGTGGAGAAAGATG
NM_001314052.2
Human c-MycGTAGACGGCATCGCAGCTTG
GAAATACGGCTGCACCGAGTC
NM_002467.6


Karyotyping

In T flasks (Corning), cells were grown sparsely and treated with colcemid (Gibco) at a final concentration of 50 µg/mL for one hour. The cells were trypsinized, centrifuged at 2,000 g for 5 minutes, resuspended in 8 mL of 0.075 M KCl (Sigma), and incubated at 37℃ for 25 minutes. A fixative solution consisting of 1 part acetic acid (Sigma) and 3 parts methanol (Sigma) was added to a final volume of 10 mL, delicately mixed, and incubated at -20℃ for 30 minutes. After centrifugation, the supernatant was removed, and a final volume of 10 mL of cold fixative solution (Invitrogen) was added to cleanse the cell suspension. This stage must be repeated three times. After the final centrifugation, the pelleted cells should be suspended in a small volume of fixative solution. Allow the cell suspension to dry at 90℃ for one hour after being placed on a cold-wet slide. The slides were treated with trypsin and stained with Giemsa staining solution (Sigma). For chromosome analysis, slides were analyzed under an optical microscope (Nikon, Tokyo, Japan).

Embryonic body (EB) formation and in vitro differentiation

Colonies of canine iPSCs were separated mechanically to eliminate differentiated cells and the feeder layer. They were cut into tiny pieces with a glass pipette and plated on petri dishes containing the in KnockOut DMEM (Gibco) supplemented with 20% (v/v) KSR (Gibco), 1% (v/v) penicillin-streptomycin (Gibco), 0.1 mM NEAA (Sigma). After five days, EBs were transferred to dishes coated with 0.1% gelatin. The EBs on the plate spontaneously differentiated for a minimum of three weeks. Every two days, a portion of the EB formation and differentiation medium was replaced.

Statistical analysis

The data were obtained from at least three independent experiments and presented as the mean ± standard error of the mean (SEM). All experimental results were statistically analyzed using SPSS 22.0 (SPSS Inc., Chicago, IL, USA). A t-test was used to assess statistical significance. A p-value below 0.05 was deemed statistically significant (*p < 0.05; **p < 0.01).

RESULTS

Vitamin C promotes reprogramming of canine fibroblasts

For the generation of canine iPSCs, retroviruses containing Yamanaka’s factors (Oct4, Sox2, Klf4, c-Myc; OSKM) and GFP were transduced into CFFs (Fig. 1A). Following two rounds of transduction with OSKM, the culture medium was subsequently transitioned to ESC medium containing Vc in order to investigate the impact of Vc on the reprogramming activity. During the initial phase of reprogramming, there were no notable variations in morphology observed between the cells treated with Vc and the control group (data not shown). Nevertheless, following a culture period of 10 days, it was noticed that the Vc-treated group exhibited a higher number of AP-positive colonies (Fig. 1B). The colonies were categorized into three distinct groups based on their respective sizes. The classification of colonies is as follows: colonies with a diameter exceeding 0.8 mm are categorized as group A, colonies with a diameter ranging from 0.25 to 0.8 mm are classified as group B, and colonies with a diameter less than 0.25 mm fall under group C (Fig. 1C). The results obtained from groups A, B, and C collectively demonstrated that the application of Vc treatment led to a higher number of AP positive colonies being produced. The middle-sized group B, which exhibited a preferable colony size for mechanical passaging, demonstrated notable distinctions. Based on the results obtained from this work, it was shown that the reprogramming of CFFs into iPSCs was significantly enhanced with the application of Vc treatment.

Figure 1.Vitamin C enhances the reprogramming of canine fetal fibroblasts (CFFs). (A) A schematic diagram illustrating the process of generating canine induced pluripotent stem cells (iPSCs). CFFs were transduced with Yamanaka’s factors (Oct4, Sox2, Klf4, c-Myc; OSKM) and GFP. At day 5, infected cells were split on feeders during the gradual transition to ES media, vitamin C (Vc) was or was not administered (Vc treated or control). (B) AP staining of untreated or Vc-treated infected CFFs. (C) Number of AP-positive colonies in three size-classified groups. Group A (0.8 mm-), Group B (0.25-0.8 mm), Group C (~0.25 mm). Mean ± SEM of five independent experiments are shown (*p < 0.05).

Vitamin C has an effect on the reprogramming process

To determine how Vc improves the efficiency of canine iPSC generation, the observation of GFP expression was conducted in both Vc-treated and untreated infected cells to validate the effective transduction of OSKM. The Vc-treated group displayed a greater number of GFP-positive cells than the control group after being transferred to the feeder layer and supplemented with Vc (Fig. 2A). This observation suggests that the treatment with Vc improves the efficacy of OSKM transduction using retroviruses. We then assessed the proliferation ability of the cells treated with Vc by CFSE assay. It was observed that the group treated with Vc exhibited a decreased mean fluorescence intensity, indicating an increased proliferation ability (Fig. 2B). Subsequently, so as to figure out the impact of Vc treatment on enhancing reprogramming efficiency, we assessed the endogenous gene expression of Oct4 following to infection. Consequently, it was shown that the expression level of endogenous Oct4 was significantly elevated upon treatment with Vc (Fig. 2C).

Figure 2.The early phase of cellular reprogramming is affected by vitamin C. (A) GFP expression depending on whether vitamin C (Vc) is treated or not. (B) CFSE assay in infected cells treated with Vc or not. The black histogram represents the Vc treated group, while the gray histogram represents the control group. (C) Expression of the canine Oct4 gene in infected cells treated with or without Vc. qPCR was used to examine Oct4 gene expression at 0 h, 24 h, and 72 h post-infection. Data are presented as meanSEM (*p < 0.05, **p < 0.01) from three replicated experiments.

Characterization was performed on vitamin C-treated canine iPSCs

The characterization of iPSCs derived from CFFs was subsequently examined, as described in the experimental design depicted in Fig. 1A. Following mechanical passaging, the cells displayed a morphology characterized by the formation of compact colonies with well-defined, rounded edges (Fig. 3A), closely similar to the appearance of human and previously reported canine ESCs. To verify the pluripotency of these colonies, which were created from CFFs in the presence of Vc, we conducted an analysis of pluripotency marker expression. The expression of pluripotency markers such as Oct4, Sox2, Nanog, and Tra-1-60 was observed in colonies at passage 5 (Fig. 3B). To verify the pluripotency of Vc-treated canine iPSCs, the endogenous gene expression was evaluated. Canine-specific pluripotency marker genes Oct4, Nanog, Rex1, and Telomerase were expressed in canine iPSCs at passage 5 (Fig. 3C). Particularly, the entire silencing of exogenously transduced human OSKM factors was observed exclusively as they developed in the presence of Vc. (Fig. 3D). Karyotype analysis revealed that these cells had a normal 78, XX karyotype, with 38 matched pairs at passage 5, with no identifiable aneuploidy, tetraploidy, or other structural rearrangements, indicating genomic stability of cells despite their increased cell proliferation under Vc treatment (Fig. 3E).

Figure 3.Canine iPSCs treated with vitamin C were characterized. (A) The morphology of the canine iPSC colonies after treatment with vitamin C (Vc). Colonies were detected in passages 1 and 3 (P1 and P3). Scale bar = 400 μm. (B) Characterization by immunofluorescence of canine iPSCs treated with Vc. The cells were stained with the following pluripotency markers: Oct4, Sox2, Nanog, and Tra-1-60. (C) Characterization by PCR of Vc-treated canine iPSCs. The expression of pluripotent stem cell marker genes (Oct4, Rex1, Nanog, and telomerase) was analyzed. (D) Verification of transgene expression. PCR was used to examine exogenous transgene expression in canine iPSCs treated with or without Vc (+Vc and –Vc). (E) Karyotype analysis in Vc-treated canine iPSCs. Normal: 78, XX with 38 matched pairs of autosomes in cells.

Vitamin C-treated canine iPSCs have the ability to differentiate

To assess the capacity for differentiation in vitro, we induced spontaneous differentiation through the removal of growth factors, resulting in the formation of embryoid bodies (EBs). The colonies were divided mechanically into small fragments, which were then cultured on dishes. After four days, their morphology changed gradually, and they aggregated into round spheres similar to those described in previous reports (Fig. 4A) (Nishimura et al., 2017). On the fifth day of the experiment, the expression of pluripotency markers, including Rex1 and Nanog, was completely suppressed (Fig. 4B). Each EB was then adhered to cell culture substrates and subjected to continuous cultivation after its formation. After a few weeks in culture, these attached cells exhibited heterogeneous cell morphology and increased expression of three germ layer-specific markers, βIII-tubulin, Cxcr4, and Nkx, for the ectoderm, endoderm, and mesoderm, respectively (Fig. 4C). This demonstrated that iPSCs treated with Vc were capable of differentiating in vitro into three germ layers.

Figure 4.Canine iPSCs treated with vitamin C were capable of in vitro differentiation. (A) The Formation of embryonic bodies (EBs) from vitamin C (Vc)-treated canine iPSCs. Above is a picture of floating EBs on day 4, and below is a picture of attached EBs on day 21. Scale bar = 400 μm. (B) Nanog and Rex1 gene expression in canine iPSCs and differentiated embryonic bodies. (C) Expression of three germ layer marker genes in EBs. qPCR was used to examine the expression of βIII-tubulin, Cxcr4, and Nkx in differentiated EBs. Data are presented as mean ± SEM (*p < 0.05) from three replicated experiments.

DISCUSSION

Stem cells with the ability to differentiate into specialized cells and self-replicate are regarded as novel tools in the field of regenerative medicine (Zakrzewski et al., 2019). Particularly in the case of canines, they have been acknowledged as a representative companion animal and an appropriate model for human disease. Nevertheless, despite the growing demand for canine pluripotent stem cells and recent advances, there are still many hurdles, such as low reprogramming efficiency, incomplete differentiation potential, and defects in exogenous gene silencing (Betts and Tobias, 2015). Slow and ineffective reprogramming is a significant drawback for the production of iPSCs from most species, not just canine stem cells. Here, we demonstrate that CFFs can be reprogrammed into a pluripotent state via the ectopic expression of four transcription factors; human Oct4, Sox2, Klf4, and c-Myc (OSKM) via retroviral transduction, a technique that has been successful in other species. Adding Vc to the culture medium transformed canine somatic cells into iPSCs of superior quality.

Vc treatment during reprogramming increases the formation of putative iPSC colonies by a significant margin. As reported in mice and humans, we examined the rate of AP-positive colony formation treated with Vc in order to determine whether it can facilitate effective reprogramming in canines (Esteban et al., 2010). Despite being AP-positive, the sizes of the colonies differed. As a result, we classified these colonies into three groups based on their size: Group A has recently initiated the process of colony formation, group B has reached a size suitable for mechanical passage, and group C is on the verge of margin differentiation. We observed significant differences in the group B, 10 days after reseeding onto feeder cells, indicating that an increased number of probable colonies can be obtained. These findings indicate that Vc may facilitate the formation of colonies and reprogramming of CFFs.

Upon observing the colony-forming properties of canine iPSCs, we determined that an increased number of cells could be generated via Vc treatment, resulting in the detection of more GFP-positive cells. It suggests that a greater number of infected cells could be produced from the same number of initial cells. Vc enhanced the efficiency of OSKM transduction using retroviruses, as demonstrated by the findings. Given that retroviruses have an exceptional ability to infect cells with a high proliferative capacity, we evaluated the proliferative capacity of the Vc-treated cells using the CFSE assay. After three days of culture, the proliferative capacity of Vc-treated cells was greater than that of untreated cells. This observation suggests that the treatment with Vc enhances the efficacy of retrovirus transduction by enhancing proliferation capacity. Additionally, there was no significant difference in the rate of apoptotic cell death (data not shown). It seems that the observed enhancement in cell proliferation cannot be attributed to variations in cell mortality. The effects of Vc on cell proliferation have been the subject of considerable discussion. In tumor cells, Vc treatment inhibits cell proliferation, which is associated with a cell cycle arrest due to an increase in p53-p21 concentration (Hahm et al., 2007). In contrast, Vc can promote the proliferation of adipose-derived stem cells by inhibiting the p53-p21 pathway (Zhang et al., 2016). In addition, different Vc concentrations and cell types likely result in distinct effects; thus, additional research is required to determine the precise mechanism at work in OSKM-infected CFFs.

Endogenous Oct4 is the core pluripotent gene required for maintaining stemness, and is therefore used as a marker of effective reprogramming. We analyzed the expression of the endogenous Oct4 gene during early reprogramming to further confirm the improved reprogramming efficiency. At 24 h and 72 h after transfer to the feeder layer, cells treated with Vc exhibited a dramatic increase in Oct4 expression, whereas cells in the control group exhibited a delayed increase. Comparing each condition at 24 h and 72 h, cells treated with Vc exhibited significantly higher expression levels. According to these findings, Vc treatment increases infection rate by promoting cell proliferation and accelerates the expression of the endogenous core pluripotent gene, thereby enhancing early reprogramming efficiency.

Infected CFFs that were supplemented with Vc successfully formed flat, densely packed cells with rounded margins, similar to previously reported primed state stem cell morphology (Lee et al., 2011; Whitworth et al., 2012; Koh et al., 2013; Baird et al., 2015; Gonçalves et al., 2017). Additionally, we confirmed that canine iPSCs expressed pluripotent surface markers and endogenous pluripotent genes. Vc-treated canine iPSCs suppress four exogenous transcription factors after three passages, whereas untreated control cells continue to express OSKM ectopically. Since the effective silencing of exogenous reprogramming factors has been regarded as evidence of a complete reprogramming (Hotta and Ellis, 2008), we suppose that Vc could aid in obtaining reprogrammed cells of higher quality. Vc have been shown to be efficacious in converting pre-iPSCs to iPSCs in a previous report (Esteban et al., 2010). Vc accelerated transcriptome changes during reprogramming and may have promoted epigenetic modifications that permit additional change. In order to determine the precise function of Vc in epigenetic modification, additional research is required.

CONCLUSION

In this study, Vc treatment facilitates efficient reprogramming and generates canine iPSCs of superior quality. We demonstrated that Vc treatment during somatic cell reprogramming in canines promotes cell proliferation and retrovirus transduction. Consequently, exogenous reprogramming factors were efficiently silenced, and the induction of endogenous pluripotent genes was accelerated in the Vc-treated group.

Acknowledgements

This study was supported by 2023 the RDA Fellowship Program of National Institute of Animal Science, Rural Development Administration, Republic of Korea.

Author Contributions

Conceptualization, J.S.L., J.H.H.; methodology, J.S.L., S.E.K.; investigation, J.S.L., S.E.K.; data curation, S.E.K.; writing—original draft preparation, J.S.L., S.E.K.; writing—review and editing, K.B.O., J.H.H.; supervision, J.H.H.; project administration, J.H.H.; funding acquisition, J.H.H.

Funding

This work was supported by the National Research Council of Science & Technology (NST) granted by the Korea government (MIST) (grant no. CRC21021).

Ethical Approval

Not applicable.

Consent to Participate

Not applicable.

Consent to Publish

Not applicable.

Availability of Data and Materials

Not applicable.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Vitamin C enhances the reprogramming of canine fetal fibroblasts (CFFs). (A) A schematic diagram illustrating the process of generating canine induced pluripotent stem cells (iPSCs). CFFs were transduced with Yamanaka’s factors (Oct4, Sox2, Klf4, c-Myc; OSKM) and GFP. At day 5, infected cells were split on feeders during the gradual transition to ES media, vitamin C (Vc) was or was not administered (Vc treated or control). (B) AP staining of untreated or Vc-treated infected CFFs. (C) Number of AP-positive colonies in three size-classified groups. Group A (0.8 mm-), Group B (0.25-0.8 mm), Group C (~0.25 mm). Mean ± SEM of five independent experiments are shown (*p < 0.05).
Journal of Animal Reproduction and Biotechnology 2023; 38: 199-208https://doi.org/10.12750/JARB.38.4.199

Fig 2.

Figure 2.The early phase of cellular reprogramming is affected by vitamin C. (A) GFP expression depending on whether vitamin C (Vc) is treated or not. (B) CFSE assay in infected cells treated with Vc or not. The black histogram represents the Vc treated group, while the gray histogram represents the control group. (C) Expression of the canine Oct4 gene in infected cells treated with or without Vc. qPCR was used to examine Oct4 gene expression at 0 h, 24 h, and 72 h post-infection. Data are presented as meanSEM (*p < 0.05, **p < 0.01) from three replicated experiments.
Journal of Animal Reproduction and Biotechnology 2023; 38: 199-208https://doi.org/10.12750/JARB.38.4.199

Fig 3.

Figure 3.Canine iPSCs treated with vitamin C were characterized. (A) The morphology of the canine iPSC colonies after treatment with vitamin C (Vc). Colonies were detected in passages 1 and 3 (P1 and P3). Scale bar = 400 μm. (B) Characterization by immunofluorescence of canine iPSCs treated with Vc. The cells were stained with the following pluripotency markers: Oct4, Sox2, Nanog, and Tra-1-60. (C) Characterization by PCR of Vc-treated canine iPSCs. The expression of pluripotent stem cell marker genes (Oct4, Rex1, Nanog, and telomerase) was analyzed. (D) Verification of transgene expression. PCR was used to examine exogenous transgene expression in canine iPSCs treated with or without Vc (+Vc and –Vc). (E) Karyotype analysis in Vc-treated canine iPSCs. Normal: 78, XX with 38 matched pairs of autosomes in cells.
Journal of Animal Reproduction and Biotechnology 2023; 38: 199-208https://doi.org/10.12750/JARB.38.4.199

Fig 4.

Figure 4.Canine iPSCs treated with vitamin C were capable of in vitro differentiation. (A) The Formation of embryonic bodies (EBs) from vitamin C (Vc)-treated canine iPSCs. Above is a picture of floating EBs on day 4, and below is a picture of attached EBs on day 21. Scale bar = 400 μm. (B) Nanog and Rex1 gene expression in canine iPSCs and differentiated embryonic bodies. (C) Expression of three germ layer marker genes in EBs. qPCR was used to examine the expression of βIII-tubulin, Cxcr4, and Nkx in differentiated EBs. Data are presented as mean ± SEM (*p < 0.05) from three replicated experiments.
Journal of Animal Reproduction and Biotechnology 2023; 38: 199-208https://doi.org/10.12750/JARB.38.4.199

Table 1 . The primers employed in this study.

GenePrimer sequence (5’ to 3’)Accession number
Canine GapdhTATCAGTTGTGGATCTGACCTG
GCGTCGAAGGTGGAAGAGT
NM_001003142.2
Canine Oct4TCGTGAAGCCGGACAAGGAGAAG
AGGAACATGTTCTCCAGGTTGCCT
XM_038553312.1
Canine Sox2ATGTACAACATGATGGAGACGGAGCTG
TCACATGTGCGAGAGGGGCAGT
XM_038583467.1
Canine Rex1GAGAAGCATCTCCTCGTCCA
GCGTTTCCCACATCCTTCAA
XM_038559236.1
Canine NanogCCAAGCACCCAACTCTAGGG
GGGTCGCATCTTCCTTCCTCGC
LC672615.1
Canine telomeraseTGCGTCTGGTACACAATCACGTC
TGACCAGCAGGAAGTCGTCCACCA
NM_001031630.2
Canine NkxCCAAGGACCCTCGAGCTGA
CGACAGATACCGCTGCTGCT
NM_001010959.3
Canine Cxcr4ACTCCATGAAGGAACCCTGCTT
TGCCCACTATGCCAGTCAAGA
NM_001048026.1
Canine βIIItubulinCCGGAACCATGGACAGCGTC
AGCGGAGAGAAGTAGTGACG
XM_005620536.3
Human Oct4GTAGACGGCATCGCAGCTTG
AGCCAGGTCCGAGGATCAAC
OK304863.1
Human Sox2GTAGACGGCATCGCAGCTTG
TCCGGGCTGTTTTTCTGGTT
NM_003106.4
Human Klf4GTAGACGGCATCGCAGCTTG
CGCGAACGTGGAGAAAGATG
NM_001314052.2
Human c-MycGTAGACGGCATCGCAGCTTG
GAAATACGGCTGCACCGAGTC
NM_002467.6

References

  1. Baird A, Guest DJ. 2015. Derivation of canine induced pluripotent stem cells. Reprod. Domest. Anim. 50:669-676.
    Pubmed CrossRef
  2. Betts DH and Tobias IC. 2015. Canine pluripotent stem cells: are they ready for clinical applications? Front. Vet. Sci. 2:41.
    Pubmed KoreaMed CrossRef
  3. Chan EM, Ratanasirintrawoot S, Park IH, Manos PD, Loh YH, Huo H, Miller JD, Hartung O, Rho J, Ince TA, Schlaeger TM. 2009. Live cell imaging distinguishes bona fide human iPS cells from partially reprogrammed cells. Nat. Biotechnol. 27:1033-1037.
    Pubmed CrossRef
  4. Esteban MA, Wang T, Qin B, Yang J, Qin D, Cai J, Li W, Weng Z, Chen J, Ni S, Chen K, Li Y, Liu X, Xu J, Zhang S, Li F, He W, Labuda K, Song Y, Peterbauer A, Wolbank S, Redl H, Zhong M, Cai D, Pei D. 2010. Vitamin C enhances the generation of mouse and human induced pluripotent stem cells. Cell Stem Cell 6:71-79.
    Pubmed CrossRef
  5. Esteban MA, Xu J, Yang J, Peng M, Qin D, Li W, Jiang Z, Chen J, Deng K, Zhong M, Cai J, Pei D. 2009. Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J. Biol. Chem. 284:17634-17640.
    Pubmed KoreaMed CrossRef
  6. Gonçalves NJN, Bressan FF, Roballo KCS, Meirelles FV, Xavier PLP, Fukumasu H, Williams C, Breen M, Koh S, Sper R, Ambrósio CE. 2017. Generation of LIF-independent induced pluripotent stem cells from canine fetal fibroblasts. Theriogenology 92:75-82.
    Pubmed CrossRef
  7. Hahm E, Jin DH, Kang JS, Kim YI, Hong SW, Lee SK, Kim HN, Jung DJ, Kim JE, Shin DH, Hwang YI, Kim YS, Hur DY, Yang Y, Cho D, Lee WJ. 2007. The molecular mechanisms of vitamin C on cell cycle regulation in B16F10 murine melanoma. J. Cell. Biochem. 102:1002-1010.
    Pubmed CrossRef
  8. Hochedlinger K and Plath K. 2009. Epigenetic reprogramming and induced pluripotency. Development 136:509-523.
    Pubmed KoreaMed CrossRef
  9. Hotta A and Ellis J. 2008. Retroviral vector silencing during iPS cell induction: an epigenetic beacon that signals distinct pluripotent states. J. Cell. Biochem. 105:940-948.
    Pubmed CrossRef
  10. Kere M, Siriboon C, Lo NW, Ju JC. 2013. Ascorbic acid improves the developmental competence of porcine oocytes after parthenogenetic activation and somatic cell nuclear transplantation. J. Reprod. Dev. 59:78-84.
    Pubmed KoreaMed CrossRef
  11. Kim JS, Choi HW, Choi S, Seo HG, Moon SH, Do JT. 2014. Conversion of partially reprogrammed cells to fully pluripotent stem cells is associated with further activation of stem cell maintenance- and gamete generation-related genes. Stem Cells Dev. 23:2637-2648.
    Pubmed KoreaMed CrossRef
  12. Koh S, Thomas R, Tsai S, Bischoff S, Lim JH, Breen M, Piedrahita JA. 2013. Growth requirements and chromosomal instability of induced pluripotent stem cells generated from adult canine fibroblasts. Stem Cells Dev. 22:951-963.
    Pubmed KoreaMed CrossRef
  13. Lee AS, Xu D, Plews JR, Nguyen PK, Nag D, Lyons JK, Han L, Hu S, Lan F, Liu J, Huang M, Narsinh KH, Long CT, de Almeida PE, Levi B, Kooreman N, Bangs C, Pacharinsak C, Ikeno F, Yeung AC, Gambhir SS, Robbins RC, Wu JC. 2011. Preclinical derivation and imaging of autologously transplanted canine induced pluripotent stem cells. J. Biol. Chem. 286:32697-32704.
    Pubmed KoreaMed CrossRef
  14. Liao J, Cui C, Chen S, Ren J, Chen J, Gao Y, Li H, Jia N, Cheng L, Xiao L. 2009. Generation of induced pluripotent stem cell lines from adult rat cells. Cell Stem Cell 4:11-15.
    Pubmed CrossRef
  15. Liu H, Zhu F, Yong J, Zhang P, Hou P, Li H, Jiang W, Cai J, Liu M, Cui K, Qu X, Xiang T, Lu D, Chi X, Gao G, Ji W, Deng H. 2008. Generation of induced pluripotent stem cells from adult rhesus monkey fibroblasts. Cell Stem Cell 3:587-590.
    Pubmed CrossRef
  16. Nishimura T, Hatoya S, Kanegi R, Wijesekera DPH, Sanno K, Tanaka E, Sugiura K, Hiromitsu Tamada NK, Inaba T. 2017. Feeder-independent canine induced pluripotent stem cells maintained under serum-free conditions. Mol. Reprod. Dev. 84:329-339.
    Pubmed CrossRef
  17. Ostrander EA, Patterson DF. 2000. Canine genetics comes of age. Trends Genet. 16:117-124.
    Pubmed CrossRef
  18. Parrinello S, Samper E, Krtolica A, Goldstein J, Campisi J. 2003. Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat. Cell Biol. 5:741-747.
    Pubmed KoreaMed CrossRef
  19. Schneider MR, Wolf E, Braun J, Adler H. 2008. Canine embryo-derived stem cells and models for human diseases. Hum. Mol. Genet. 17(R1):R42-R47.
    Pubmed CrossRef
  20. Starkey MP, Scase TJ, Murphy S. 2005. Dogs really are man's best friend--canine genomics has applications in veterinary and human medicine! Brief. Funct. Genomic. Proteomic. 4:112-128.
    Pubmed CrossRef
  21. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Yamanaka S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861-872.
    Pubmed CrossRef
  22. Takahashi K and Yamanaka S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676.
    Pubmed CrossRef
  23. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Jones JM. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145-1147.
    Pubmed CrossRef
  24. Whitworth DJ, Wolvetang EJ. 2012. Generation and characterization of LIF-dependent canine induced pluripotent stem cells from adult dermal fibroblasts. Stem Cells Dev. 21:2288-2297.
    Pubmed CrossRef
  25. Xu X, Smorag L, Nakamura T, Kimura T, Dressel R, Fitzner A, Tan X, Linke M, Zechner U, Pantakani DV. 2015. Dppa3 expression is critical for generation of fully reprogrammed iPS cells and maintenance of Dlk1-Dio3 imprinting. Nat. Commun. 6:6008.
    Pubmed KoreaMed CrossRef
  26. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Thomson JA. 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science 318:1917-1920.
    Pubmed CrossRef
  27. Zakrzewski W, Dobrzyński M, Rybak Z. 2019. Stem cells: past, present, and future. Stem Cell Res. Ther. 10:68.
    Pubmed KoreaMed CrossRef
  28. Zhang P, Li J, Qi Y, Zou Y, Liu L, Tang X, Duan J, Zeng G. 2016. Vitamin C promotes the proliferation of human adipose-derived stem cells via p53-p21 pathway. Organogenesis 12:143-151.
    Pubmed KoreaMed CrossRef

JARB Journal of Animal Reproduction and Biotehnology

qr code

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663