JARB Journal of Animal Reproduction and Biotehnology

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663

Article Search

Original Article

Article Original Article
Split Viewer

Journal of Animal Reproduction and Biotechnology 2023; 38(4): 275-290

Published online December 31, 2023

https://doi.org/10.12750/JARB.38.4.275

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Comparative pluripotent characteristics of porcine induced pluripotent stem cells generated using different viral transduction systems

Sang-Ki Baek1,#,§ , In-Won Lee1,3,# , Yeon-Ji Lee1,3 , Bo-Gyeong Seo2,3 , Jung-Woo Choi4 , Tae-Suk Kim1 , Cheol Hwangbo3 and Joon-Hee Lee1,5,*

1Department of Animal Bioscience, College of Agriculture & Life Sciences, Gyeongsang National University, Jinju 52828, Korea
2Division of Life Science, College of Natural Sciences, Gyeongsang National University, Jinju 52828, Korea
3Division of Applied Life Science, Gyeongsang National University, Jinju 52828, Korea
4College of Animal Life Science, Kangwon National University, Chuncheon 24341, Korea
5Institute of Agriculture & Life Science, College of Agriculture & Life Sciences, Gyeongsang National University, Jinju 52828, Korea

Correspondence to: Joon-Hee Lee
E-mail: sbxjhl@gnu.ac.kr

#These authors contributed equally to this work.

§Current affiliation: Gyeongsangnamdo Livestock Experiment Station, Sancheong 52263, Korea

Received: December 12, 2023; Revised: December 19, 2023; Accepted: December 19, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background: Porcine pluripotent stem cells (pPSCs) would provide enormous potential for agriculture and biomedicine. However, authentic pPSCs have not established yet because standards for pPSCs-specific markers and culture conditions are not clear. Therefore, the present study reports comparative pluripotency characteristics in porcine induced pluripotent stem cells (piPSCs) derived from different viral transduction and reprogramming factors [Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM)].
Methods: Porcine fibroblasts were induced into Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) by using Lentiviral vector and Sev-iPSCs (OSKM) by using Sendaiviral vector. Expressions of endogenous or exogenous pluripotency-associated genes, surface marker and in vitro differentiation in between Lenti-piPSCs (OSKM), Lenti-iPSCs (OSKMNL) and Sev-piPSCs (OSKM) were compared.
Results: Colonial morphology of Lenti-iPSCs (OSKMNL) closely resembles the naïve mouse embryonic stem cells colony for culture, whereas Sev-iPSCs (OSKM) colony is similar to the primed hESCs. Also, the activity of AP shows a distinct different in piPSCs (AP-positive (+) Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM), but AP-negative (-) Lenti-iPSCs (OSKM)). mRNAs expression of several marker genes (OCT-3/4, NANOG and SOX2) for pluripotency was increased in Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM), but Sev-iPSCs (OSKM). Interestingly, SSEA-1 of surface markers was expressed only in Sev-iPSCs (OSKM), whereas SSEA-4, Tra-1-60 and Tra-1-81 were positively expressed in Lenti-iPSCs (OSKMNL). Exogenous reprogramming factors continuously expressed in Lenti-iPSCs (OSKMNL) for passage 20, whereas Sev-iPSCs (OSKM) did not express any exogenous transcription factors. Finally, only Lenti-iPSCs (OSKMNL) express the three germ layers and primordial germ cells markers in aggregated EBs.
Conclusions: These results indicate that the viral transduction system of reprograming factors into porcine differentiated cells display different pluripotency characteristics in piPSCs.

Keywords: induced pluripotent stem cells, Lenti-viral, pluripotency, porcine, Sendai-viral

A new type of embryonic-like stem cells had been derived from induced pluripotent stem cells (iPSCs) by reprogramming differenced somatic cells with defined factors. These cells have the self-renewal capacity that proliferates indefinitely and pluripotency that differentiates potentially into other cell types (Romito and Cobellis, 2016), and allow for patient-specific stem cells to be produced because of avoidance of rejection of their derivatives by immune system (Park et al., 2008a). Mouse iPSCs were first produced by a retrovirus vector transduction of OCT-3/4, SOX2, c-MYC, KLF4 (Takahashi and Yamanaka, 2006), and human iPSCs were later produced by similar integrating viral transduction using either a combination of different pluripotency genes (OCT-3/4, SOX2, c-MYC, KLF4 or OCT-3/4, SOX2, c-MYC, KLF4, NANOG, LIN28) (Park et al., 2008b; Tomioka et al., 2010). Since then, several different approaches including gene or protein transduction and application of pharmacological agents had been introduced to establish superior reproducible and efficacious iPSCs (Müller and Lengerke, 2009). However, gene transduction using a viral vector is still the primary protocol for inducing ectopic expression of reprogramming factors in differentiated somatic cells.

The reprogramming procedures developed in mouse and human have been adapted to an increasingly demand of specific specie, pig, which has an excellent resource for disease modeling, drug discovery and regenerative medicine (Esteban et al., 2009; Ezashi et al., 2009; Wu et al., 2009). The derivation of iPSCs by using the Japanese group reprogramming procedure yields either naïve or primed stemness states, depending on the species. For instance, mouse iPSCs generally have the properties of naïve state like embryonic stem cells (ESCs), while human iPSCs so far reported have features of the primed state like epiblast stem cells (EpiSCs). Interestingly, the colonies derived from porcine iPSCs resemble human ESCs rather than mouse ESCs in morphology. Porcine iPSCs like human ESCs are totally dependent upon on basic fibroblasts growth factor (bFGF) and Activin/Nodal signaling pathway for maintaining self-renewal and pluripotency (Dahéron et al., 2004; Vallier et al., 2009; Alberio et al., 2010). On the contrary, mouse ESCs are dependent on the cytokines leukemia inhibitory factor (LIF) and bone morphogenetic protein-4 (BMP-4) to maintain the undifferentiated state (Smith et al., 1988; Ying et al., 2003).

Porcine pluripotent stem cells may be especially valuable because the pig is a prime biomedical model for tissue and organ transplantation. Among domestic animals, induced pluripotent stem cells (iPSCs) have been first successfully generated from swine (Esteban et al., 2009; Ezashi et al., 2009; Wu et al., 2009). It was clearly evidenced that the porcine iPSCs isolated have an ability to differentiate into tissue types reflective of the three germ layers (endoderm, mesoderm and ectoderm), spontaneously within either embryoid bodies or teratomas (Ezashi et al., 2012). However, it remains unclear whether or not the continued expression of reprogramming genes complicated directed differentiation along specific lineages, or if the protocols and reagents used have not been optimized for pig. Some discrepancies relating to whether or not the lines express the surface molecules stage-specific embryonic antigens (SSEA-1, SSEA-3 and SSEA-4) and the tumor rejection antigens (Tra 1-60 and Tra 1-81) have been reported. Mouse and human ESCs slightly differ in their display of cell surface antigens. For example, SSEA-1 is expressed on mESCs but it is absent on hESCs, and different surface markers (SSEA-3 and SSEA-4) are displayed on the human pluripotent stem cells (Henderson et al., 2002).

Reprogramming factors needed to make porcine iPSCs were introduced by infecting the PFFs with non-integrative methods [plasmids, Sendai virus, synthetic mRNAs and recombinant proteins] (Telugu et al., 2010). The delivery of transgenes using viral vectors, which are stably expressed, is considered the most useful tool for inducing low cytotoxicity and inserting transgenes into the host genome (Zhang and Godbey, 2006). Porcine induced pluripotent stem cells (piPSCs) generated using lentiviral vectors, often referred to as lentivirus-mediated reprogramming, involve the use of lentiviruses as a vehicle to introduce reprogramming factors into somatic cells, ultimately leading to the generation of piPSCs. This method is a variation of the commonly used induced pluripotent stem cell (iPSC) generation technique and is utilized for creating piPSCs. The Sendai virus infects the target cells and delivers the reprogramming factors into the cell’s cytoplasm. Importantly, the Sendai virus does not integrate its genetic material into the host cell’s DNA. Various lines of evidence indicate that efficient cell reprogramming requires the sustained and simultaneous expression of several exogenous factors at least 10-20 days (Jaenisch and Young, 2008). After reprogramming has been completed, these exogenous factors should be replaced promptly with their endogenous counterparts if the cells are to acquire autoregulated pluripotency (Jaenisch and Young, 2008).

Here we have transformed porcine fetal fibroblasts (PFFs) into iPSCs by delivering transcription factors with integrating (lentiviral transfection) and non-integrating (Sendai virus infection) vectors. Therefore, we have demonstrated that porcine iPSCs generated by infecting the PFFs with non-integrative method (Sendai virus infection) might carry less of an exogenous transgenes expression than porcine iPSCs generated by infecting the PFFs with integrating (lentiviral transfection) vectors.

All chemicals and reagents were purchased from SigmaAldrich Co. (St. Louis, MO, USA) unless otherwise mentioned. And all materials and methods were performed accordingly, as previously described by Lee et al. (2023).

Culture of porcine fibroblasts

Porcine fetal fibroblasts (PFFs) were isolated from the fetus that becomes roughly with the 30 day and cultured for 1-2 passages in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO, Grand Island, NY, USA) culture medium containing 1.25% minimal essential medium (MEM) nonessential amino acids, 1.25% β-mercaptoethanol, 1% penicillin/streptomycin supplemented with 10% fetal bovine serum (FBS; GIBCO, Lot No. 2039230, Grand Island, NY, USA) at 39℃ in 5% CO2. Until the use, primary cultured cells were stored in liquid nitrogen (LN2).

Induction of porcine induced pluripotent stem cells

Lenti-viral transduction was performed using the viPSTM Vector Kit (Thermo Fisher ScientificTM, USA) following the manufacturer’s instructions. The PFFs were thawed and cultured for 18 h at a density of 1 × 104 cells per well (4 cm2) in 12-well culture dishes (Nunc, USA). These cells were transduced with Lenti-viral vectors encoding four (POU5F1, SOX2, KLF4, C-MYC; OSKM) and six (POU5F1, SOX2, KLF4, C-MYC, NANOG, LIN28; OSKMNL) human transcription factors to initiate reprogramming via ectopic expression. The transduction to target cells was performed under multiplicity of infection (MOI) 25 condition. After 24 h of transduction, the cells were harvested by trypsinization and seeded onto mitomycin C inactivated mouse embryonic fibroblasts (iMEFs) in stem cell medium, which is composed of Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12; GIBCO, Grand Island, NY, USA) containing 1% MEM nonessential amino acids, 1% penicillin/streptomycin, 2 mM L-glutamine (GIBCO, Grand Island, NY, USA), 0.1 mM β-mercaptoethanol, 10% FBS, 10% knock-OutTM serum replacer (KSR; Thermo Fisher ScientificTM, Grand Island, NY, USA) and 20 ng/mL leukemia inhibitor factor (LIF). Lenti-virus porcine induced pluripotent stem cells (Lenti-piPSCs) were passaged using the manual method and medium was changed each day.

On the other hand, Sendai-viral transduction was performed using the CytoTuneTM-iPS Reprogramming Kit (Life Technologies, Frederick, MD, USA) following the manufacturer’s instructions. Approximately 1 × 105 PFFs were seeded per well in a 6-well plate (Nunc, USA) and incubated at 39℃ and 5% CO2. 2 days later, cells were transduced with the CytoTune iPS Reprogramming Kit containing Sendai-viral vectors encoding four human transcription factors (POU5F1, SOX2, KLF4, C-MYC; OSKM) using the F gene-defective vector. The transduction to target cells was performed under multiplicity of infection (MOI) 3 condition, as described in the manufacturer’s protocols. 1 day after transduction, the medium was replaced with fresh PFFs culture medium and then the cells were cultured in PFFs culture medium for 6-7 days. On day 8 after transduction, cells were transferred to mitomycin C inactivated mouse embryonic fibroblasts (iMEFs). After culturing overnight in the PFFs culture medium, the medium was replaced daily with stem cell medium, which is composed of KnockOutTM DMEM/F12 (Thermo Fisher ScientificTM, Grand Island, NY, USA) containing 1% MEM nonessential amino acids, 1% penicillin/streptomycin, 2 mM L-glutamine, 0.1 mM β-mercaptoethanol, 20% KSR and 4 ng/mL basic fibroblast growth factor-2 (bFGF; R&D system, Minneapolis, MN, USA). Sendai-virus porcine induced pluripotent stem cells (Sev-piPSCs) were passaged using the manual method and medium was changed each day.

Determining reprogramming efficiency with alkaline phosphatase

Reprogramming efficiency of porcine induced pluripotent stem cells (piPSCs) was determined as the number of colonies formed per the number of infected cells seeded. Lenti-iPSCs and Sev-iPSCs were identified in relation to ES-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. AP staining was performed in two ways (basic AP staining and AP live stain). For the basic AP staining, the Lenti-iPSCs lines were fixed with by 4% paraformaldehyde (PFA) for 1-2 min and then washed three times with PBS. AP staining was performed using the Alkaline Phosphatase Detection Kit (Chemicon/Milipore, Darmstadt, Germany) according to the manufacturer’s protocol. Briefly, Lenti-iPSCs lines were incubated in stain solution (the ratio of Naphthol:Fast Red Violet:Water solution = 2:1:1) at room temperature until suitable staining developed. Percentage of AP positive (+) colonies was calculated as AP positive (+) Lenti-piPSCs colonies per total Lenti-piPSCs colonies. Images were observed with the LEICA microscope (TYPE 090-135 001) and captured by the Nikon’s NIS Elements microscope imaging software (version 3.0). For AP live staining, the Sev-piPSCs lines were washed three times with pre-warmed DMEM/F-12. The AP live staining was performed using the Alkaline Phosphatase Live Stain (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Briefly, Sev-piPSCs lines were incubated with the 1 × LIVE AP substrate for 20-30 min and washed twice with the basal DMEM/F-12 media to remove excess substrate. Following the final wash, images were examined using fluorescence microscope (LEICA DM 2500; Leica, Wetzlar, Germany).

Immunocytochemistry

For immunocytochemistry, Lenti-piPSCs and Sev-piPSCs were fixed in 4% paraformaldehyde (PFA) for 15 min and then incubated with blocking solution containing 5% bovine serum albumin (BSA) for 1 h at room temperature. These cells were incubated with primary antibodies under following conditions at 4℃ overnight: OCT-3/4 (1:100, Santa Cruz Biotechnology, catalogue number #SC-6828, Santa Cruz, CA, USA), NANOG (1:100, Abcam, catalogue number #500-p237, Cambridge, MA, USA), SOX2 (10 ng/mL, R&D System, catalogue number #MAB2018, Minneapolis, MN, USA), SSEA-1 (1:100, Santa Cruz Biotechnology, catalogue number #SC-21702), SSEA-4 (1:100, Santa Cruz Biotechnology, catalogue number #SC-59368), Tra-1-60 (1:100, Santa Cruz Biotechnology, catalogue number #SC-21705), Tra-1-81 (1:100, Santa Cruz Biotechnology, catalogue number #SC-21706) and H3K27me3 (1:200, Abcam, catalogue number #ab192985). After overnight, the stem cells were incubated with secondary antibodies under following conditions at room temperature for 1 hour: Alexa fluor® 568 Donkey Anti-Goat IgG (1:200, Invitrogen, Carlsbad, CA, USA), Alexa Fluor® 546 Goat Anti-Rabbit IgG (1:200, Invitrogen), and Alexa Fluor® 555 Donkey Anti-Mouse IgG (1:200, Invitrogen). To indicate the nuclei in cells, 5 µg/mL of Hoechst 33342 (Life Technologies, Carlsbad, CA, USA) were treated at room temperature for 10 min. All images were examined using fluorescence microscope (LEICA DM 2500; Leica, Wetzlar, Germany).

RT-PCR and quantitative real-time PCR

Total RNAs of Lenti-piPSCs and Sev-piPSCs were extracted using Agilent RNA 6000 Nano Kit (Agilent Technologies, Lubbock, TX, USA) and RNeasy Plus Mini Kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions, respectively. cDNA was synthesized using an RevoscriptTM RT Premix (iNtRON Biotechnology Inc, Seongnam, Korea), and total RNA and cDNA were measured using MaestroNano® Spectrophotometer (MAESTROGEN Inc, USA). RT-PCR was performed by Maxime PCR Premix (iNtRON Biotechnology Inc, Seongnam, Korea) and conditions of RT-PCR were followed: pre-denaturation for 10 min at 95℃, denaturation for 30 sec at 94℃, annealing at a temperature specific for each primer set for 40 sec, extinction for 60 sec at 72℃ and final extension for 10 min at 72℃ for 40 cycles using Pro s6325 (Eppendorf, Germany). These PCR products were analyzed by 1.5% agarose gel in 1x TAE buffer. The primer list used for RT-PCR represents in Table 1. On the other hands, q-PCR was performed using the SYBR Green (TOYOBO LTD, Osaka, Japan) on the CFX connectTM real-time PCR detection system (BIO-RAD, USA) and conditions were followed: pre-denaturation for 30 sec at 95℃, denaturation for 5 sec at 95℃, annealing at a temperature specific for each primer set for 10 sec and extinction for 15 sec at 72℃ for 40 cycles. Data analysis was used to ΔΔCt method and gene expression was normalized relative to reference gene (GAPDH). The primer list used for qRT-PCR represents in Table 2.

Table 1 . Reverse transcription-PCR primer lists used in this study

GeneSequence (5’→3’)Target size (bp)References

ForwardReverse
VasaGCAGCCTTTCTCTTGCCAATCCTTTGATGGCATTCCTGGG400NM_001291682.1
Cardiac actinGTCCCCATTTACGAGGGCTATACCAATGAAGGAGGGCTGG319NM_001170517.2
NestinACCCTAAGTTGGAGCTGCATGTCCTGGTCTCTGATCTCGG245XM_005663265.2
GATA 6AAACCTGTGTGCAATGCTTGTCACCTATGTACAGCCCGTCT330XM_005656114
GAPDHTGACCCCTTCATTGACCTCCGGCTGACGATCTTGAGGGAGT343NM_001206359.1

Table 2 . Quantitative real-time PCR primer lists used in this study

GeneSequence (5’→3’)Target size (bp)References

ForwardReverse
SOX2CATGTCCCAGCACTACCAGAGAGAGAGGCAGTGTACCGTT66NM_001123197.1
NANOGCCCGAAGCATCCATTTCCAGGATGACATCTGCAAGGAGGC86DQ_447201.1
OCT-3/4GGATATACCCAGGCCGATGTGTCGTTTGGCTGAACACCTT68NM_001113060.1
GAPDHGGTCATCATCTCTGCCCCTTTCACGCCCATCACAAACATG53NM_001206359.1


Cell cycle, population doubling time and karyotyping analysis

For cell cycle analysis, Lenti-piPSCs and Sev-piPSCs were dissociated with 0.05% Trypsin/EDTA at 39℃ for 5 min. These cells digested to single cells were incubated with propidium iodide (PI) staining solution [50 µL/mL PI, 0.1 mg/mL RNase A, Triton X-100 in PBS] at 37℃ for 40 min. The samples were analyzed by using BD FACS Calibur flow cytometer (BD Biosciences, Becton Dickinson, NJ, USA) and cellquest software. Maximum excitation of PI bound to DNA was at 483 nm and emission was at 635 nm. The results were analyzed by using FlowJo software version 10.0.7 (TREE STAR Inc.). On the other hands, the population doubling time (PDT) of dissociated Lenti-piPSCs and Sev-piPSCs were calculated using the duration*log (2) /log (final concentration)-log (initial concentration) formula at each passage.

For karyotyping analysis, Lenti-piPSCs and Sev-piPSCs were cultured with 0.1 µL/mL of colcemide (Biological Industries Israel Beit Haemek LTD, Kibbutz Beit Haemek, Israel) in culture medium at 37℃ for 1 hour and then harvested using 0.05% Trypsin/EDTA. Harvested single cells were incubated with hypotonic solution (0.4% NaCl and 0.4% KCl in H2O) at 39℃ for 6 min and then fixed in fixative (3:1 = methanol:acetic acid). The cell pellet suspended in 1 mL of fixation solution was dropped onto cold slide and then dried. The chromosomes of metaphase stage stained with Giemsa were patterned by standard G-banding techniques.

In vitro differentiation

For the production of embryoid bodies (EBs), Lenti-piPSCs and Sev-piPSCs were dissociated with 0.05% Trypsin/EDTA at 39℃ for 5 min and collected in differentiation medium [DMEM/F12 supplemented with 1% MEM nonessential amino acids, 1% penicillin/streptomycin, 2 mM L-glutamine, 0.1 mM β-mercaptoethanol and 20% FBS]. Collected these cells were aggregated into EBs for 3 day in hanging drop at a seeding density of 1 × 103 cells/drop. EBs were transferred to low attachment dishes (Corning, USA) and kept in suspension for another 4 days. After 4 days, they were transferred to 0.1% gelatin solution (Millipore, Darmstadt, Germany) coated dishes with differentiation medium and medium were changed daily for 14 days.

Statistical analysis

At least three replicates were measured for each group. The statistical significance (p value) in mean values among multiple sample groups was evaluated by one way ANOVA, or two-way ANOVA with Bonferroni’s post hoc test using the Prism 4 program (GraphPad Software, San Diego, Ca, USA). Values shown on graphs represent the mean ± S.E.

Induction efficiency of porcine fibroblasts into porcine induced pluripotent stem cells by using Lentiviral vector

This experiment was carried out to examine the optimal induction efficiency of porcine fetal fibroblasts (PFFs) into piPSCs by using Lentiviral vectors in various culture conditions. PFFs were transduced by using Lenti-viral vectors with combinations of four (POU5F1, SOX2, KLF4, C-MYC; OSKM) or six (POU5F1, SOX2, KLF4, C-MYC, NANOG, LIN28; OSKMNL) reprogramming factors under multiplicity of infection (MOI) 25 condition for 24 h and then cultured on mitomycin C inactivated mouse embryonic fibroblasts (iMEFs) with under three culture conditions [DMEM/F12 + 20% FBS with 20 ng/mL LIF, DMEM/F12 + 20% KSR with 20 ng/mL LIF and DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF]. As shown in Table 3, colonies derived from piPSCs transduced by using six reprogramming factors (OSKMNL) at transduction (TD) 6 and 16 days were investigated in all culture conditions. However, colonies derived from piPSCs transduced by using four reprogramming factors (OSKM) were induced only in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF culture condition (Fig. 1B). In the next experiment, AP-positive (+) colonies were shown in piPSCs transduced by six reprogramming factors (OSKMNL) in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF culture condition at passage 3, 10 and 20, whereas piPSCs transduced by using four reprogramming factors (OSKM) were shown AP-negative (-) at all-time points (p < 0.0001) (Fig. 1A and 1C).

Table 3 . Reprogramming efficiency of porcine fibroblasts by using Lentiviral vector in various culture conditions

Base mediumSupplementReprogramming factors deliveredColonies obtained after TD 6 (%)Colonies obtained after TD 16 (%)AP-positive colonies at passage 3 (%)
DMEM/F12 + 20% FBSLIFOSKM
OSKMNL
0
0.1
0
1.38
0
68.3
DMEM/F12 + 20% KSRLIFOSKM
OSKMNL
0
0.09
0
1.42
0
68.0
DMEM/F12 + 10% FBS/KSRLIFOSKM
OSKMNL
0.08
0.12
1.40
1.49
0.8
97.0

Porcine fetal fibroblasts (PFFs) were reprogrammed using four (OSKM) and six (OSKMNL) human factors under multiplicity of infection (MOI) 25 condition for 24 h and then cultured on mouse embryonic feeder (MEF) cells treated with mitomycin C under three different culture conditions: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) + 20% fetal bovine serum (FBS) with 20 ng/mL leukemia inhibitor factor (LIF), DMEM/F12 + 20% knock-OutTM serum replacer (KSR) with 20 ng/mL LIF and DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF. After transduction, reprogramming efficiency was determined as the percentage of colonies formed per the number of infected cells seeded (10,000 cells). Lenti-virus induced pluripotent stem cells (Lenti-iPSCs) were identified based on embryonic stem cell (ESC)-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. Reprogramming factors delivered represents OSKM or OSKMNL combination of reprogramming factors: O, OCT 4; S, SOX2; K, KLF4; M, CMYC; N, NANOG; L, LIN28.


Figure 1. Comparison of induction efficiency between Lenti-viral vector and Sendai-viral vector. (A) Alkaline phosphatase (AP) staining of the colonies derived from transduced cells with Sendai- and Lenti-viral vectors after transduction (TD) 16 days at passage 3, 10 and 20, respectively. Scale bar = 100 µm. (B) The number of colony formation generated by Sendai-viral vectors with four reprogramming factors (POU5F1, SOX2, KLF4, C-MYC; Sev-iPSCs (OSKM)), Lenti-viral vectors with four (POU5F1, SOX2, KLF4, C-MYC; Lenti-iPSCs (OSKM) and six (POU5F1, SOX2, KLF4, C-MYC, NANOG, LIN28; Lenti-iPSCs (OSKMNL) reprogramming factors was counted after TD 6 to 16 days. (C) The percentage of AP-positive (+) colonies derived from Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10 and 20. All the values were represented as mean ± standard errors of five replicates and the impacts of each gene delivery systems (Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (10, 20 and 30) and their interactions on AP activity were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. a,bValue in same columns with different superscripts are significantly different (p < 0.0001). ns, not significant.

Induction efficiency of porcine fibroblasts into porcine induced pluripotent stem cells by using Sendaivirus vector

To examine the optimal induction efficiency of PFFs into piPSCs by using Sendai-viral vector in various culture conditions, PFFs were transduced by using Sendai-viral vector with combinations of four reprogramming factors (POU5F1, SOX2, KLF4, C-MYC; OSKM) under multiplicity of infection (MOI) 3 condition for 24 h and then cultured on iMEFs under twelve culture conditions [DMEM/F12 + 20% FBS with 20 ng/mL LIF or 4 ng/mL bFGF; DMEM/F12 + 20% KSR with 20 ng/mL LIF or 4 ng/mL bFGF; DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF or 4 ng/mL bFGF; KnockOut DMEM/F12 + 20% FBS with 20 ng/mL LIF or 4 ng/mL bFGF; KnockOut DMEM/F12 + 20% KSR with 20 ng/mL LIF or 4 ng/mL bFGF; KnockOut DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF or 4 ng/mL bFGF]. As shown in Table 4, colonies of piPSCs transduced by using Sendaiviral vectors with four reprogramming factors (OSKM) were constructed only in KnockOut DMEM/F12 + 20% KSR + 4 ng/mL bFGF culture condition after TD 6 and 16 days. However, colonies of piPSCs transduced by using the Sendaiviral vectors containing four reprogramming factors (OSKM) were not induced in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF culture condition (Fig. 1B). In the next experiment, AP-positive (+) colonies were showed in piPSCs transduced by using four reprogramming factors (OSKM) in KnockOut DMEM/F12 + 20% KSR + 4 ng/mL bFGF at all-time points (p < 0.0001) (Fig. 1A and 1C).

Table 4 . Reprogramming efficiency of porcine fibroblasts by using Sendaivirus vector in various culture conditions

Base mediumSupplementReprogramming factors deliveredColonies obtained after TD 6 (%)Colonies obtained after TD 16 (%)AP-positive colonies at passage 3 (%)
DMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0
DMEM/F12 + 20% KSRLIF
bFGF
OSKM0
0
0
0
0
0
DMEM/F12 + 10% FBS/KSRLIF
bFGF
OSKM0
0
0
0
0
0
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0.02
0
0.02
0
92.5
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0

Porcine fetal fibroblasts (PFFs) were reprogrammed using four human factors (OSKM) under multiplicity of infection (MOI) 3 condition for 24 h and then cultured on mouse embryonic feeder (MEF) cells treated with mitomycin C under twelve different culture conditions: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) + 20% fetal bovine serum (FBS) with 20 ng/mL leukemia inhibitor factor (LIF), DMEM/F12 + 20% FBS with 4 ng/mL basic fibroblast growth factor-2 (bFGF), DMEM/F12 + 20% knock-OutTM serum replacer (KSR) with 20 ng/mL LIF, DMEM/F12 + 20% KSR with 4 ng/mL bFGF, DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF, DMEM/F12 + 10% FBS/KSR with 4 ng/mL bFGF, KnockOutDMEM/F12 + 20% FBS with 20 ng/mL LIF, KnockOutDMEM/F12 + 20% FBS with 4 ng/mL bFGF, KnockOutDMEM/F12 + 20% KSR with 20 ng/mL LIF, KnockOutDMEM/F12 + 20% KSR with 4 ng/mL bFGF, KnockOutDMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF and KnockOutDMEM/F12 + 10% FBS/KSR with 4 ng/mL bFGF. After transduction, reprogramming efficiency was determined as the percentage of colonies formed per the number of infected cells seeded (100,000 cells). Sendai-virus induced pluripotent stem cells (Sev-iPSCs) were identified based on embryonic stem cell (ESC)-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. Reprogramming factors delivered represents OSKM combination of reprogramming factors: O, OCT 4; S, SOX2; K, KLF4; M, CMYC.



Comparative expression of endogenous pluripotency-associated genes in between Lenti-piPSCs and Sev-piPSCs

We evaluated the expression of endogenous pluripotency marker genes (OCT-3/4, NANOG, SOX2, KLF4, CMYC and LIN28) with different passage courses (3, 10 and 20) in previously established culture condtions [Sev-piPSCs (OSKM) cultured in KnockOut DMEM/F12 + 20% KSR with 4 ng/mL bFGF; Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) cultured in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF] using comparative real-time PCR. There was no difference in expressions of endogenous the pluripotency-associated genes from viral transduction systems (Fig. 2A and 2B). Interestingly, expression of endogenous NANOG gene was significantly higher in Lenti-piPSCs (OSKMNL) at all-time points than as compared to PFFs, Lenti-piPSCs (OSKM) and Sev-piPSCs (OSKM) (p < 0.0001). The expression of other endogenous pluripotency-associated genes (OCT-3/4, SOX2, KLF4 and CMYC) was shown in Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL), whereas Lin28 was not detected in all piPSCs (Fig. 2B).

Figure 2. Expression of pluripotent marker genes in between Lenti-iPSCs and Sev-iPSCs. (A) Relative mRNA levels of OCT-3/4, NANOG, SOX2, KLF4, CMYC, LIN28 in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) with different passage course (3, 10 and 20). Data were normalized to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and all the values were represented as mean ± standard errors of three replicates. The impacts of each gene transduction systems (PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (3, 10 and 20) and their interactions on relative mRNA levels were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. (B) Expression analysis of pluripotency marker genes (OCT-3/4, NANOG, SOX2, KLF4, CMYC, LIN28) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10, 20 respectively.

Comparative expression of exogenous reprograming genes in between Lenti-piPSCs and Sev-piPSCs

This experiment was performed in order to examine the continuous expression of exogenous reprogramming factors in piPSCs constructed by using Sendaiviral and Lentiviral vectors. We evaluated the expression of exogenous reprogramming genes (hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) with different passage courses (3, 10 and 20) in Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) using comparative real-time PCR. There was a difference in expressions of exogenous reprogramming genes in piPSCs constructed from viral transduction systems (Fig. 3A and 3B). The expression patterns of hOCT-3/4, hNANOG, hSOX2, hKLF4 and hCMYC decreased significantly lower in Sev-piPSCs (OSKM) at all-time points than as compared to Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) (p < 0.0001). However, Lenti-piPSCs (OSKMNL) induced highly expressions of exogenous reprogramming factors (hOCT-3/4, hNANOG, hSOX2, hKLF4 and hCMYC). Interestingly, the mRNA expression of hLIN28 was not detected in all piPSCs (Fig. 3A and 3B).

Figure 3. Comparison of expression of transgene genes between Lenti-iPSCs and Sev-iPSCs. (A) Relative mRNA levels of hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28 in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) with different passage courses (3, 10 and 20). Data were normalized to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and all the values were represented as mean ± standard errors of three replicates. The impacts of each gene delivery systems (PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (3, 10 and 20) and their interactions on relative mRNA levels were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. (B) Expression analysis of transgene genes (*hOCT-3/4, *hNANOG, *hSOX2, *hKLF4, *hCMYC, *hLIN28, hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) in Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10, 20, respectively. *Primer contains woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) region within viPS lentiviral vector. Expression analysis of transgene genes (*SEV, *KOS, *KLF4, *CMYC, hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) in Sev-iPSCs (OSKM) at passage 3, 10, 20, respectively. *Primer contains SeV genome sequences.

Comparative expression of pluripotency and surface markers in Lenti-piPSCs and Sev-piPSCs

Expression of OCT-3/4, NANOG and SOX2 proteins in the colonies of Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) was relatively higher at passage 10 and 20, demonstrating that Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) expressed the core pluripotency genes (Fig. 4A). However, OCT-3/4 and SOX2 proteins in colony of Lenti-piPSCs (OSKM) were expressed at passage 10, but not expressed at passage 20. Interestingly, there was no expression of NANOG protein in Lenti-piPSCs (OSKM) at passage 10 and 20 (Fig. 4A). On the other hand, SSEA-1 was expressed in only Sev-piPSCs (OSKM), whereas SSEA-4 was expressed in only Lenti-piPSCs (OSKMNL). However, there was no expression of TRA-1-60 and TRA-1-81 in both Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL). All of surface markers was not expressed in Lenti-piPSCs (OSKM) (Fig. 4A).

Figure 4. Expression of pluripotent, surface and differentiated markers in Lenti-iPSCs and Sev-iPSCs. (A) Immunocytochemistry of pluripotency markers (OCT-3/4, NANOG and SOX2) and surface markers (SSEA-1, SSEA-4, TRA-1-60 and TRA-1-81) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 10 and 20, respectively. Inset: Immunostaining of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL), Blue is Hoechst 33342 signal and indicate nuclei. Scale bar = 50 µm. (B) Trimethylation of histone H3 at lysine 27 (H3K27me) in PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). Blue: staining of Hoechst 33342, Red: staining of H3K27me protein. Scale bar = 50 µm.

In order to examine the epigenetic mechanism of differentiation-associated gene repression at the time of conoly formation, we immunolabeled three piPSCs types (Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL)) with an antibody against trimethylation of histone H3 at lysine 27 (H3K27me3) (Fig. 4B). Expression of H3K27me3 was down-regulated in the colonies of Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL), whereas was up-regulated in PFFs and Lenti-piPSCs (OSKM).

Cell cycle phase and population doubling time in Lenti-piPSCs and Sev-piPSCs

The cell cycle of Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) was analyzed using FACS and FlowJo. The greater part of PFFs was remained at G0/G1 stage. Additionally Lenti-piPSCs (OSKM) were slightly higher in the G0/G1 stage than Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL). However, Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) were slightly increased in G2/M phase than Lenti-piPSCs (OSKM) (p < 0.05) (Fig. 5A and 5B). As shown in Fig. 5C, PDT of Lenti-piPSCs (OSKMNL) was significantly shortened than that of other groups, whereas PDT of Sev-piPSCs (OSKM) was significantly lengthened (p < 0.05).

Figure 5. Flow-cytometric analysis of cell cycle phase-specific population and population doubling time (PDT) in Lenti-iPSCs and Sev-iPSCs. (A) Cell-cycle analysis of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) was analyzed by using FACS and Flow Jo. (B) The cell cycle distribution of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and PFFs were analyzed. All the values were represented as mean ± standard errors. (C) The population doubling time (PDT) was calculated in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and PFFs. a,b,c,dValue in same columns with different superscripts are significantly different (p < 0.05) with two-way ANOVA and Bonferroni’s post-hoc test.

In vitro differentiation of Lenti-piPSCs and Sev-piPSCs

To investigate in vitro differentiation capacity of Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL), the piPSCs cultured in differentiation medium were aggregated in hanging drop at a seeding density of 1 × 103 cells/drop for 3 days. And then aggregated EBs were attached on 0.1% gelatin-coated dishes. After 14 days, attached EBs started to show the morphologies of differentiated cells (Fig. 6A). EBs aggregated from Lenti-piPSCs (OSKMNL) strongly expressed all of differentiation marker genes (GATA6, NESTIN and CARDIAC ACTIN), but slightly expressed a primordial germ cells marker (VASA). However, EBs derived from Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKM) did not show the expression of CARDIAC ACTIN and VASA. Interestingly, GATA 6 as an endoderm marker was not detected in EBs derived from Sev-piPSCs (OSKM) (Fig. 6B). Finally, karyotype analysis was carried out in Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) to demonstrate the presence of chromosomal normalities. Our result presented a normal chromosome content (2N = 38) in more than 70% of the examined metaphase piPSCs derived from the viral transduction systems (Fig. 6C).

Figure 6. In vitro differentiation and karyotype analysis of Lenti-iPSCs and Sev-iPSCs. (A) Changes in the morphology of embryoid bodies (EBs) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). (B) Gene expression of differentiation markers [GATA6: endoderm, NESTIN: ectoderm and CARDIAC ACTIN: mesoderm and VASA: primordial germ cells marker] in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). Scale bar = 100 µm. (C) Karyotyping indicates a normal chromosome in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) when compared with PFFs.

In the present study, we observed pluripotent characteristics of porcine induced pluripotent stem cells (piPSCs) which produced by delivering reprogramming factors with integrating Lentiviral vector and non-integrating Sendaiviral vector into the host genome. Lentivirus-mediated reprogramming is a preferentially used method for generating piPSCs because Lentiviral vector is able to integrate efficiently reprogramming factors into differentiated cell’s genome, ensuring stable and long-term expression of these factors (Ezashi et al., 2009; Kim et al., 2009). Instead, Sendaivirus-mediated reprogramming has been adapted for inducing low cytotoxicity through a type of RNA virus because the Sendaiviral vector does not integrate its reprogramming factors into the host genome unlike Lentiviruses. The ectopic reprogramming factors introduced by the Lentiviral or Sendaiviral vector induce the genetic and epigenetic changes necessary to convert the differentiated cells into pluripotent stem cells (PSCs). However, one potential problem of the methods is the risk of insertional mutagenesis, where the integration of Lentiviral DNAs into the host genome may disrupt the normal function of endogenous genes and lead to unintended genetic changes. To solve this problem, the non-integrating process may reduce the risk of genetic mutations and makes it a safer choice to produce piPSCs for research and potential therapeutic purposes in a porcine model. Therefore, the delivery of reprogramming factors using Sendai viral vectors has been considered the safest tool for inducing low cytotoxicity without inserting transgenes into the host genome.

So far, culture conditions have not been optimized to induce efficiently reprogramming and ensure the long-term stability of piPSCs depending upon the endogenous pluripotency machinery. Therefore, the effect of culture on virus-mediated reprogrammed cells is of significance for generating bona fide piPSCs. In this study, we have found that the most reliable piPSCs are generated by the integrating Lentiviral vector (Lenti-iPSCs (OSKMNL)) including specific six transcription factors (POU5F1, SOX2, KLF4, C-MYC, NANOG and LIN28) and non-integrating Sendaiviral vector (Sev-iPSCs (OSKM)) including four transcription factors (POU5F1, SOX2, KLF4 and C-MYC). After the transduction, Lenti-iPSCs (OSKMNL) cultured in DMEM/F12 + 10% FBS/KSR supplemented with 20 ng/mL of leukemia inhibitory factor (LIF) produce the highest rates of colonies and alkaline phosphatage (AP) activity. Sev-iPSCs (OSKM) survive only in KnockOut DMEM/F12 + 20% KSR with 4 ng/mL of basic fibroblast growth factor-2 (bFGF) culture condition and express positively the AP activity. However, in the case of the Lentiviral vector (Lenti-iPSCs (OSKM)) including four transcription factors (POU5F1, SOX2, KLF4 and C-MYC), few colonies were produced in DMEM/F12 + 10% FBS/KSR with 20 ng/mL of LIF culture condition after the transduction and the AP activity did short-lived.

They were previously reported that pluripotent characteristics of porcine embryonic stem cells (pESCs), porcine epiblast stem cells (pEpiSCs) and piPSCs are quite similar to humans, as evidenced the primed pluripotent state regarding gene expression patterns (Alberio et al., 2010; Telugu et al., 2010; Choi et al., 2013; Park et al., 2013; Baek et al., 2021). In this study, as pluripotent characteristics of piPSCs generated through different viral transduction systems, Lenti-iPSCs (OSKMNL) resembled the naïve mouse embryonic stem cells (mESCs) in colony morphology for culture, whereas Sev-iPSCs (OSKM) presented the primed human embryonic stem cells (hESCs). Although significant differences in expression of OCT-3/4 and NANOG during embryonic development were reported (Gao et al., 2010; Gao et al., 2011; Wolf et al., 2011), a pluripotent state is able to be induced in porcine cells overexpressing mouse or human reprogramming factors such as Oct-3/4 and NANOG. Endogenous OCT-3/4 gene of Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM) lines strongly expressed, as evidenced that OCT-3/4 mRNAs in all piPSCs lines positively expressed for culture at passage 3, 10 and 20. In mice, expression of NANOG gene in ESCs stabilizes the state of pluripotency without being a strict requirement for culture (Chambers et al., 2007). However, NANOG mRNAs were higher expressed in Lenti-iPSCs (OSKMNL) rather than Lenti-iPSCs (OSKM) and Sev-iPSCs (OSKM) for culture. Interestingly, endogenous SOX2, KLF4, C-MYC and LIN28 genes expression did not show significant differences in between three piPSCs lines at all passages.

As mentioned earlier, to produce bona fide iPSCs from differentiated cells, they include silencing of exogenous transgenic genes integrated into the host genome and then reactivating of endogenous pluripotency machinery expression on behalf of ectopic transgenes expression. in mice, ∼1% of primary fibroblasts could be efficiently reprogrammed to iPSCs using Sendaiviral vector installed with defined factors (OCT-3/4, SOX2, KLF4 and C-MYC) without chromosomal gene integration. In this study, Sev-iPSCs (OSKM) with human POU5F1, SOX2, KLF4 and C-MYC non-integration were produced using porcine fibroblasts. The expression of exogenous reprogramming factors (hOCT-3/4, hSOX2, hKLF4 and hC-MYC) decreased significantly in Sev-piPSCs (OSKM) than integrating Lentiviral vectors for culture. Interestingly, Lenti-piPSCs (OSKMNL) expressed highly exogenous reprogramming factors (hOCT-3/4, hNANOG, hSOX2, hKLF4 and hC-MYC). This result identified that the non-integration process like Sendaiviral vector induces silencing of transgenic genes and creates endogenous pluripotency machinery expression.

In the PSCs, pluripotency markers including OCT-3/4, NANOG and SOX2 could be detected but the stage-specific embryonic antigens (SSEA) or Tra cell-surface markers may express specifically relying on species. In the present study, immunocytochemistry revealed that Lenti-iPSCs (OSKMNL) displayed positive expression of the pluripotent markers and also expressed positively for surface markers (SSEA-4, Tra 1-60 and Tra 1-81) but not for SSEA-1. Like Lenti-iPSCs (OSKMNL), Sev-iPSCs (OSKM) presented positive expression of the pluripotent markers but only SSEA-1 among the surface markers was expressed. As showed the naïve mESCs type in morphology, Lenti-iPSCs (OSKM) presented expression of OCT-3/4 and SOX2 proteins at initial passage, however, a strong down-regulation of pluripotent markers (OCT-3/4, NANOG and SOX2) presented at further passages. It was previously reported that expression of OCT-3/4, in contrast to that of NANOG, varies from passage to passage in porcine pluripotent stem cells (Brevini et al., 2007). On the other hand, as the characteristics of inactive X-chromosome, the activation of trimethylation of histone H3 at lysine 27 (H3K27me3) represses transcription by preventing the binding of RNA-pol II (Plath et al., 2003). In the piPSCs, H3K27me3 of Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM) was negatively expressed when compared with differentiated cells (PFFs) and Lenti-iPSCs (OSKM), thereby exhibiting their own pluripotent characteristics.

In mice, the cell-cycle of ESCs is usually characterized by a shortened G1 phase (Savatier et al., 1996; Coronado et al., 2013). Also, the cell-cycle of hESCs has shown a very short G1 phase (2-3 hours) of an abbreviated cell-cycle (16-18 hours) (Becker et al., 2006; Becker et al., 2007; Ghule et al., 2011). However, in the present study, the proportion of cell-cycle in Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM) significantly decreased in G0/G1 phase but increased in G2/M phase when compared with that of the differentiated cells (PFFs). There was difference in the cell cycle of Sub G1, G0/G1, S and G2/M. These cultures showed no signs of senescence over many passages and appeared to be pluripotent as evident by their ability to form embryoid bodies (EBs). Lenti-iPSCs (OSKMNL) enhanced the reproducible ability and the efficiency of in vitro differentiation induction and strongly expressed Vasa (primordial germ cells marker), Cardiac actin (mesoderm marker), Nestin (ectoderm marker) and GATA 6 (endoderm marker) in EBs aggregated, but Sev-iPSCs (OSKM) did not express the three germ layers markers.

Taken together, we have produced different porcine iPSCs lines by delivering transcription factors with integrating Lentiviral and non-integrating Sendaiviral vectors. These results suggested that the delivery system of reprogramming factors using Sendai viral vectors induces low cytotoxicity without inserting transgenes into the host genome, but Lenti-iPSCs (OSKMNL) line produced with integrating Lenti-viral vectors including six reprogramming presents the naïve mESCs type in colony morphology and pluripotent markers expression and in vitro differentiation. These results indicate that the viral transduction system of reprograming factors into porcine differentiated cells shows different pluripotency characteristics in piPSCs.

Conceptualization, S-K.B., I-W.L. and J-H.L.; investigation, Y-J.L. and B-G.S.; methodology, T-S.K.; project administration, J-H.L.; resources, J-W.C. and J-H.L.; supervision, C.H. and J-H.L.; writing - original draft, S-K.B. and I-W.L.; writing - review & editing, C.H. and J-H.L.

This work was supported by the National Research Foundation of Korea funded by the Korean Government (2020R1l1A3072689) Republic of Korea. In-Won Lee, Yeon-Ji Lee and Bo-Gyeong Seo were supported by the scholarship from the BK21Plus Program, Ministry of Education, Republic of Korea.

  1. Alberio R, Allegrucci C. 2010. Pig epiblast stem cells depend on activin/nodal signaling for pluripotency and self-renewal. Stem Cells Dev. 19:1627-1636.
    Pubmed KoreaMed CrossRef
  2. Baek SK, Jeon SB, Seo BG, Hwangbo C, Shin KC, Choi JW, An CS, Jeong MA, Lee JH. 2021. The presence or absence of alkaline phosphatase activity to discriminate pluripotency characteristics in porcine epiblast stem cell-like cells. Cell. Reprogram. 23:221-238.
    Pubmed CrossRef
  3. Becker KA, Ghule PN, Therrien JA, Lian JB, Stein JL, Stein GS. 2006. Self-renewal of human embryonic stem cells is supported by a shortened G1 cell cycle phase. J. Cell. Physiol. 209:883-893.
    Pubmed CrossRef
  4. Becker KA, Stein JL, Lian JB, Stein GS. 2007. Establishment of histone gene regulation and cell cycle checkpoint control in human embryonic stem cells. J. Cell. Physiol. 210:517-526.
    Pubmed CrossRef
  5. Brevini TA, Tosetti V, Crestan M, Gandolfi F. 2007. Derivation and characterization of pluripotent cell lines from pig embryos of different origins. Theriogenology 67:54-63.
    Pubmed CrossRef
  6. Chambers I, Silva J, Colby D, Nichols J, Nijmeijer B, Robertson M, Vrana J, Jones K, Smith A. 2007. Nanog safeguards pluripotency and mediates germline development. Nature 450:1230-1234.
    Pubmed CrossRef
  7. Choi KH, Park JK, Kim HS, Uh KJ, Lee CK. 2013. Epigenetic changes of lentiviral transgenes in porcine stem cells derived from embryonic origin. PLoS One 8:e72184.
    Pubmed KoreaMed CrossRef
  8. Coronado D, Godet M, Bourillot PY, Tapponnier Y, Bernat A, Petit M, Afanassieff M, Markossian S, Malashicheva A, Iacone R, Savatier P. 2013. A short G1 phase is an intrinsic determinant of naïve embryonic stem cell pluripotency. Stem Cell Res. 10:118-131.
    Pubmed CrossRef
  9. Dahéron L, Opitz SL, Zaehres H, Lensch MW, Andrews PW, Daley GQ. 2004. LIF/STAT3 signaling fails to maintain self-renewal of human embryonic stem cells. Stem Cells 22:770-778.
    Pubmed CrossRef
  10. Esteban MA, Xu J, Yang J, Peng M, Qin D, Li W, Jiang Z, Chen J, Deng K, Zhong M, Cai J, Pei D. 2009. Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J. Biol. Chem. 284:17634-17640.
    Pubmed KoreaMed CrossRef
  11. Ezashi T, Telugu BP, Alexenko AP, Sachdev S, Roberts RM. 2009. Derivation of induced pluripotent stem cells from pig somatic cells. Proc. Natl. Acad. Sci. U. S. A. 106:10993-10998.
    Pubmed KoreaMed CrossRef
  12. Ezashi T, Roberts RM. 2012. Induced pluripotent stem cells from pigs and other ungulate species: an alternative to embryonic stem cells? Reprod. Domest. Anim. 47 Suppl 4:92-97.
    Pubmed CrossRef
  13. Gao Y, Hall VJ. 2010. Regulation of H3K27me3 and H3K4me3 during early porcine embryonic development. Mol. Reprod. Dev. 77:540-549.
    Pubmed CrossRef
  14. Gao Y, Jammes H, Rasmussen MA, Oestrup O, Beaujean N, Hyttel P. 2011. Epigenetic regulation of gene expression in porcine epiblast, hypoblast, trophectoderm and epiblast-derived neural progenitor cells. Epigenetics 6:1149-1161.
    Pubmed CrossRef
  15. Ghule PN, Medina R, Lengner CJ, Mandeville M, Qiao M, Dominski Z, Lian JB, Stein JL, Stein GS. 2011. Reprogramming the pluripotent cell cycle: restoration of an abbreviated G1 phase in human induced pluripotent stem (iPS) cells. J. Cell. Physiol. 226:1149-1156.
    Pubmed KoreaMed CrossRef
  16. Henderson JK, Draper JS, Baillie HS, Fishel S, Thomson JA, Andrews PW. 2002. Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens. Stem Cells 20:329-337.
    Pubmed CrossRef
  17. Jaenisch R and Young R. 2008. Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132:567-582.
    Pubmed KoreaMed CrossRef
  18. Kim D, Kim CH, Moon JI, Chung YG, Chang MY, Han BS, Ko S, Yang E, Cha KY, Kim KS. 2009. Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell 4:472-476.
    Pubmed KoreaMed CrossRef
  19. Lee IW, Lee HG, Moon DK, Lee YJ, Seo BG, Baek SK, Kim TS, Lee JH. 2023. Limited in vitro differentiation of porcine induced pluripotent stem cells into endothelial cells. J. Anim. Reprod. Biotechnol. 38:109-120.
    CrossRef
  20. Müller R and Lengerke C. 2009. Patient-specific pluripotent stem cells: promises and challenges. Nat. Rev. Endocrinol. 5:195-203.
    Pubmed CrossRef
  21. Park IH, Lerou PH, Zhao R, Daley GQ. 2008a. Generation of human-induced pluripotent stem cells. Nat. Protoc. 3:1180-1186.
    Pubmed CrossRef
  22. Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, Lerou PH, Daley GQ. 2008b. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451:141-146.
    Pubmed CrossRef
  23. Park JK, Kim HS, Uh KJ, Choi KH, Kim HM, Lee T, Yang BC, Kim HJ, Ka HH, Lee CK. 2013. Primed pluripotent cell lines derived from various embryonic origins and somatic cells in pig. PLoS One 8:e52481.
    Pubmed KoreaMed CrossRef
  24. Plath K, Fang J, Mlynarczyk-Evans SK, Cao R, Worringer KA, Wang H, de la Cruz CC, Otte AP, Zhang Y. 2003. Role of histone H3 lysine 27 methylation in X inactivation. Science 300:131-135.
    Pubmed CrossRef
  25. Romito A and Cobellis G. 2016. Pluripotent stem cells: current understanding and future directions. Stem Cells Int. 2016:9451492.
    Pubmed KoreaMed CrossRef
  26. Savatier P, Lapillonne H, van Grunsven LA, Samarut J. 1996. Withdrawal of differentiation inhibitory activity/leukemia inhibitory factor up-regulates D-type cyclins and cyclin-dependent kinase inhibitors in mouse embryonic stem cells. Oncogene 12:309-322.
  27. Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Rogers D. 1988. Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336:688-690.
    Pubmed CrossRef
  28. Takahashi K and Yamanaka S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676.
    Pubmed CrossRef
  29. Telugu BP, Roberts RM. 2010. Porcine induced pluripotent stem cells analogous to naïve and primed embryonic stem cells of the mouse. Int. J. Dev. Biol. 54:1703-1711.
    Pubmed KoreaMed CrossRef
  30. Tomioka I, Maeda T, Shimada H, Kawai K, Okada Y, Igarashi H, Oiwa R, Iwasaki T, Aoki M, Kimura T, Shiozawa S, Shinohara H, Suemizu H, Okano H. 2010. Generating induced pluripotent stem cells from common marmoset (Callithrix jacchus) fetal liver cells using defined factors, including Lin28. Genes Cells 15:959-969.
    Pubmed KoreaMed CrossRef
  31. Vallier L, Touboul T, Brown S, Cho C, Bilican B, Alexander M, Cedervall J, Chandran S, Ahrlund-Richter L, Pedersen RA. 2009. Signaling pathways controlling pluripotency and early cell fate decisions of human induced pluripotent stem cells. Stem Cells 27:2655-2666.
    Pubmed CrossRef
  32. Wolf XA, Rasmussen MA, Schauser K, Jensen AT, Hyttel P. 2011. OCT4 expression in outgrowth colonies derived from porcine inner cell masses and epiblasts. Reprod. Domest. Anim. 46:385-392.
    Pubmed CrossRef
  33. Wu Y, Chan CW, Nicholls JM, Liao S, Wu EX. 2009. MR study of the effect of infarct size and location on left ventricular functional and microstructural alterations in porcine models. J. Magn. Reson. Imaging 29:305-312.
    Pubmed CrossRef
  34. Ying QL, Nichols J, Smith A. 2003. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115:281-292.
    Pubmed CrossRef
  35. Zhang X and Godbey WT. 2006. Viral vectors for gene delivery in tissue engineering. Adv. Drug Deliv. Rev. 58:515-534.
    Pubmed CrossRef

Article

Original Article

Journal of Animal Reproduction and Biotechnology 2023; 38(4): 275-290

Published online December 31, 2023 https://doi.org/10.12750/JARB.38.4.275

Copyright © The Korean Society of Animal Reproduction and Biotechnology.

Comparative pluripotent characteristics of porcine induced pluripotent stem cells generated using different viral transduction systems

Sang-Ki Baek1,#,§ , In-Won Lee1,3,# , Yeon-Ji Lee1,3 , Bo-Gyeong Seo2,3 , Jung-Woo Choi4 , Tae-Suk Kim1 , Cheol Hwangbo3 and Joon-Hee Lee1,5,*

1Department of Animal Bioscience, College of Agriculture & Life Sciences, Gyeongsang National University, Jinju 52828, Korea
2Division of Life Science, College of Natural Sciences, Gyeongsang National University, Jinju 52828, Korea
3Division of Applied Life Science, Gyeongsang National University, Jinju 52828, Korea
4College of Animal Life Science, Kangwon National University, Chuncheon 24341, Korea
5Institute of Agriculture & Life Science, College of Agriculture & Life Sciences, Gyeongsang National University, Jinju 52828, Korea

Correspondence to:Joon-Hee Lee
E-mail: sbxjhl@gnu.ac.kr

#These authors contributed equally to this work.

§Current affiliation: Gyeongsangnamdo Livestock Experiment Station, Sancheong 52263, Korea

Received: December 12, 2023; Revised: December 19, 2023; Accepted: December 19, 2023

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background: Porcine pluripotent stem cells (pPSCs) would provide enormous potential for agriculture and biomedicine. However, authentic pPSCs have not established yet because standards for pPSCs-specific markers and culture conditions are not clear. Therefore, the present study reports comparative pluripotency characteristics in porcine induced pluripotent stem cells (piPSCs) derived from different viral transduction and reprogramming factors [Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM)].
Methods: Porcine fibroblasts were induced into Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) by using Lentiviral vector and Sev-iPSCs (OSKM) by using Sendaiviral vector. Expressions of endogenous or exogenous pluripotency-associated genes, surface marker and in vitro differentiation in between Lenti-piPSCs (OSKM), Lenti-iPSCs (OSKMNL) and Sev-piPSCs (OSKM) were compared.
Results: Colonial morphology of Lenti-iPSCs (OSKMNL) closely resembles the naïve mouse embryonic stem cells colony for culture, whereas Sev-iPSCs (OSKM) colony is similar to the primed hESCs. Also, the activity of AP shows a distinct different in piPSCs (AP-positive (+) Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM), but AP-negative (-) Lenti-iPSCs (OSKM)). mRNAs expression of several marker genes (OCT-3/4, NANOG and SOX2) for pluripotency was increased in Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM), but Sev-iPSCs (OSKM). Interestingly, SSEA-1 of surface markers was expressed only in Sev-iPSCs (OSKM), whereas SSEA-4, Tra-1-60 and Tra-1-81 were positively expressed in Lenti-iPSCs (OSKMNL). Exogenous reprogramming factors continuously expressed in Lenti-iPSCs (OSKMNL) for passage 20, whereas Sev-iPSCs (OSKM) did not express any exogenous transcription factors. Finally, only Lenti-iPSCs (OSKMNL) express the three germ layers and primordial germ cells markers in aggregated EBs.
Conclusions: These results indicate that the viral transduction system of reprograming factors into porcine differentiated cells display different pluripotency characteristics in piPSCs.

Keywords: induced pluripotent stem cells, Lenti-viral, pluripotency, porcine, Sendai-viral

INTRODUCTION

A new type of embryonic-like stem cells had been derived from induced pluripotent stem cells (iPSCs) by reprogramming differenced somatic cells with defined factors. These cells have the self-renewal capacity that proliferates indefinitely and pluripotency that differentiates potentially into other cell types (Romito and Cobellis, 2016), and allow for patient-specific stem cells to be produced because of avoidance of rejection of their derivatives by immune system (Park et al., 2008a). Mouse iPSCs were first produced by a retrovirus vector transduction of OCT-3/4, SOX2, c-MYC, KLF4 (Takahashi and Yamanaka, 2006), and human iPSCs were later produced by similar integrating viral transduction using either a combination of different pluripotency genes (OCT-3/4, SOX2, c-MYC, KLF4 or OCT-3/4, SOX2, c-MYC, KLF4, NANOG, LIN28) (Park et al., 2008b; Tomioka et al., 2010). Since then, several different approaches including gene or protein transduction and application of pharmacological agents had been introduced to establish superior reproducible and efficacious iPSCs (Müller and Lengerke, 2009). However, gene transduction using a viral vector is still the primary protocol for inducing ectopic expression of reprogramming factors in differentiated somatic cells.

The reprogramming procedures developed in mouse and human have been adapted to an increasingly demand of specific specie, pig, which has an excellent resource for disease modeling, drug discovery and regenerative medicine (Esteban et al., 2009; Ezashi et al., 2009; Wu et al., 2009). The derivation of iPSCs by using the Japanese group reprogramming procedure yields either naïve or primed stemness states, depending on the species. For instance, mouse iPSCs generally have the properties of naïve state like embryonic stem cells (ESCs), while human iPSCs so far reported have features of the primed state like epiblast stem cells (EpiSCs). Interestingly, the colonies derived from porcine iPSCs resemble human ESCs rather than mouse ESCs in morphology. Porcine iPSCs like human ESCs are totally dependent upon on basic fibroblasts growth factor (bFGF) and Activin/Nodal signaling pathway for maintaining self-renewal and pluripotency (Dahéron et al., 2004; Vallier et al., 2009; Alberio et al., 2010). On the contrary, mouse ESCs are dependent on the cytokines leukemia inhibitory factor (LIF) and bone morphogenetic protein-4 (BMP-4) to maintain the undifferentiated state (Smith et al., 1988; Ying et al., 2003).

Porcine pluripotent stem cells may be especially valuable because the pig is a prime biomedical model for tissue and organ transplantation. Among domestic animals, induced pluripotent stem cells (iPSCs) have been first successfully generated from swine (Esteban et al., 2009; Ezashi et al., 2009; Wu et al., 2009). It was clearly evidenced that the porcine iPSCs isolated have an ability to differentiate into tissue types reflective of the three germ layers (endoderm, mesoderm and ectoderm), spontaneously within either embryoid bodies or teratomas (Ezashi et al., 2012). However, it remains unclear whether or not the continued expression of reprogramming genes complicated directed differentiation along specific lineages, or if the protocols and reagents used have not been optimized for pig. Some discrepancies relating to whether or not the lines express the surface molecules stage-specific embryonic antigens (SSEA-1, SSEA-3 and SSEA-4) and the tumor rejection antigens (Tra 1-60 and Tra 1-81) have been reported. Mouse and human ESCs slightly differ in their display of cell surface antigens. For example, SSEA-1 is expressed on mESCs but it is absent on hESCs, and different surface markers (SSEA-3 and SSEA-4) are displayed on the human pluripotent stem cells (Henderson et al., 2002).

Reprogramming factors needed to make porcine iPSCs were introduced by infecting the PFFs with non-integrative methods [plasmids, Sendai virus, synthetic mRNAs and recombinant proteins] (Telugu et al., 2010). The delivery of transgenes using viral vectors, which are stably expressed, is considered the most useful tool for inducing low cytotoxicity and inserting transgenes into the host genome (Zhang and Godbey, 2006). Porcine induced pluripotent stem cells (piPSCs) generated using lentiviral vectors, often referred to as lentivirus-mediated reprogramming, involve the use of lentiviruses as a vehicle to introduce reprogramming factors into somatic cells, ultimately leading to the generation of piPSCs. This method is a variation of the commonly used induced pluripotent stem cell (iPSC) generation technique and is utilized for creating piPSCs. The Sendai virus infects the target cells and delivers the reprogramming factors into the cell’s cytoplasm. Importantly, the Sendai virus does not integrate its genetic material into the host cell’s DNA. Various lines of evidence indicate that efficient cell reprogramming requires the sustained and simultaneous expression of several exogenous factors at least 10-20 days (Jaenisch and Young, 2008). After reprogramming has been completed, these exogenous factors should be replaced promptly with their endogenous counterparts if the cells are to acquire autoregulated pluripotency (Jaenisch and Young, 2008).

Here we have transformed porcine fetal fibroblasts (PFFs) into iPSCs by delivering transcription factors with integrating (lentiviral transfection) and non-integrating (Sendai virus infection) vectors. Therefore, we have demonstrated that porcine iPSCs generated by infecting the PFFs with non-integrative method (Sendai virus infection) might carry less of an exogenous transgenes expression than porcine iPSCs generated by infecting the PFFs with integrating (lentiviral transfection) vectors.

MATERIALS AND METHODS

All chemicals and reagents were purchased from SigmaAldrich Co. (St. Louis, MO, USA) unless otherwise mentioned. And all materials and methods were performed accordingly, as previously described by Lee et al. (2023).

Culture of porcine fibroblasts

Porcine fetal fibroblasts (PFFs) were isolated from the fetus that becomes roughly with the 30 day and cultured for 1-2 passages in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO, Grand Island, NY, USA) culture medium containing 1.25% minimal essential medium (MEM) nonessential amino acids, 1.25% β-mercaptoethanol, 1% penicillin/streptomycin supplemented with 10% fetal bovine serum (FBS; GIBCO, Lot No. 2039230, Grand Island, NY, USA) at 39℃ in 5% CO2. Until the use, primary cultured cells were stored in liquid nitrogen (LN2).

Induction of porcine induced pluripotent stem cells

Lenti-viral transduction was performed using the viPSTM Vector Kit (Thermo Fisher ScientificTM, USA) following the manufacturer’s instructions. The PFFs were thawed and cultured for 18 h at a density of 1 × 104 cells per well (4 cm2) in 12-well culture dishes (Nunc, USA). These cells were transduced with Lenti-viral vectors encoding four (POU5F1, SOX2, KLF4, C-MYC; OSKM) and six (POU5F1, SOX2, KLF4, C-MYC, NANOG, LIN28; OSKMNL) human transcription factors to initiate reprogramming via ectopic expression. The transduction to target cells was performed under multiplicity of infection (MOI) 25 condition. After 24 h of transduction, the cells were harvested by trypsinization and seeded onto mitomycin C inactivated mouse embryonic fibroblasts (iMEFs) in stem cell medium, which is composed of Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12; GIBCO, Grand Island, NY, USA) containing 1% MEM nonessential amino acids, 1% penicillin/streptomycin, 2 mM L-glutamine (GIBCO, Grand Island, NY, USA), 0.1 mM β-mercaptoethanol, 10% FBS, 10% knock-OutTM serum replacer (KSR; Thermo Fisher ScientificTM, Grand Island, NY, USA) and 20 ng/mL leukemia inhibitor factor (LIF). Lenti-virus porcine induced pluripotent stem cells (Lenti-piPSCs) were passaged using the manual method and medium was changed each day.

On the other hand, Sendai-viral transduction was performed using the CytoTuneTM-iPS Reprogramming Kit (Life Technologies, Frederick, MD, USA) following the manufacturer’s instructions. Approximately 1 × 105 PFFs were seeded per well in a 6-well plate (Nunc, USA) and incubated at 39℃ and 5% CO2. 2 days later, cells were transduced with the CytoTune iPS Reprogramming Kit containing Sendai-viral vectors encoding four human transcription factors (POU5F1, SOX2, KLF4, C-MYC; OSKM) using the F gene-defective vector. The transduction to target cells was performed under multiplicity of infection (MOI) 3 condition, as described in the manufacturer’s protocols. 1 day after transduction, the medium was replaced with fresh PFFs culture medium and then the cells were cultured in PFFs culture medium for 6-7 days. On day 8 after transduction, cells were transferred to mitomycin C inactivated mouse embryonic fibroblasts (iMEFs). After culturing overnight in the PFFs culture medium, the medium was replaced daily with stem cell medium, which is composed of KnockOutTM DMEM/F12 (Thermo Fisher ScientificTM, Grand Island, NY, USA) containing 1% MEM nonessential amino acids, 1% penicillin/streptomycin, 2 mM L-glutamine, 0.1 mM β-mercaptoethanol, 20% KSR and 4 ng/mL basic fibroblast growth factor-2 (bFGF; R&D system, Minneapolis, MN, USA). Sendai-virus porcine induced pluripotent stem cells (Sev-piPSCs) were passaged using the manual method and medium was changed each day.

Determining reprogramming efficiency with alkaline phosphatase

Reprogramming efficiency of porcine induced pluripotent stem cells (piPSCs) was determined as the number of colonies formed per the number of infected cells seeded. Lenti-iPSCs and Sev-iPSCs were identified in relation to ES-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. AP staining was performed in two ways (basic AP staining and AP live stain). For the basic AP staining, the Lenti-iPSCs lines were fixed with by 4% paraformaldehyde (PFA) for 1-2 min and then washed three times with PBS. AP staining was performed using the Alkaline Phosphatase Detection Kit (Chemicon/Milipore, Darmstadt, Germany) according to the manufacturer’s protocol. Briefly, Lenti-iPSCs lines were incubated in stain solution (the ratio of Naphthol:Fast Red Violet:Water solution = 2:1:1) at room temperature until suitable staining developed. Percentage of AP positive (+) colonies was calculated as AP positive (+) Lenti-piPSCs colonies per total Lenti-piPSCs colonies. Images were observed with the LEICA microscope (TYPE 090-135 001) and captured by the Nikon’s NIS Elements microscope imaging software (version 3.0). For AP live staining, the Sev-piPSCs lines were washed three times with pre-warmed DMEM/F-12. The AP live staining was performed using the Alkaline Phosphatase Live Stain (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Briefly, Sev-piPSCs lines were incubated with the 1 × LIVE AP substrate for 20-30 min and washed twice with the basal DMEM/F-12 media to remove excess substrate. Following the final wash, images were examined using fluorescence microscope (LEICA DM 2500; Leica, Wetzlar, Germany).

Immunocytochemistry

For immunocytochemistry, Lenti-piPSCs and Sev-piPSCs were fixed in 4% paraformaldehyde (PFA) for 15 min and then incubated with blocking solution containing 5% bovine serum albumin (BSA) for 1 h at room temperature. These cells were incubated with primary antibodies under following conditions at 4℃ overnight: OCT-3/4 (1:100, Santa Cruz Biotechnology, catalogue number #SC-6828, Santa Cruz, CA, USA), NANOG (1:100, Abcam, catalogue number #500-p237, Cambridge, MA, USA), SOX2 (10 ng/mL, R&D System, catalogue number #MAB2018, Minneapolis, MN, USA), SSEA-1 (1:100, Santa Cruz Biotechnology, catalogue number #SC-21702), SSEA-4 (1:100, Santa Cruz Biotechnology, catalogue number #SC-59368), Tra-1-60 (1:100, Santa Cruz Biotechnology, catalogue number #SC-21705), Tra-1-81 (1:100, Santa Cruz Biotechnology, catalogue number #SC-21706) and H3K27me3 (1:200, Abcam, catalogue number #ab192985). After overnight, the stem cells were incubated with secondary antibodies under following conditions at room temperature for 1 hour: Alexa fluor® 568 Donkey Anti-Goat IgG (1:200, Invitrogen, Carlsbad, CA, USA), Alexa Fluor® 546 Goat Anti-Rabbit IgG (1:200, Invitrogen), and Alexa Fluor® 555 Donkey Anti-Mouse IgG (1:200, Invitrogen). To indicate the nuclei in cells, 5 µg/mL of Hoechst 33342 (Life Technologies, Carlsbad, CA, USA) were treated at room temperature for 10 min. All images were examined using fluorescence microscope (LEICA DM 2500; Leica, Wetzlar, Germany).

RT-PCR and quantitative real-time PCR

Total RNAs of Lenti-piPSCs and Sev-piPSCs were extracted using Agilent RNA 6000 Nano Kit (Agilent Technologies, Lubbock, TX, USA) and RNeasy Plus Mini Kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions, respectively. cDNA was synthesized using an RevoscriptTM RT Premix (iNtRON Biotechnology Inc, Seongnam, Korea), and total RNA and cDNA were measured using MaestroNano® Spectrophotometer (MAESTROGEN Inc, USA). RT-PCR was performed by Maxime PCR Premix (iNtRON Biotechnology Inc, Seongnam, Korea) and conditions of RT-PCR were followed: pre-denaturation for 10 min at 95℃, denaturation for 30 sec at 94℃, annealing at a temperature specific for each primer set for 40 sec, extinction for 60 sec at 72℃ and final extension for 10 min at 72℃ for 40 cycles using Pro s6325 (Eppendorf, Germany). These PCR products were analyzed by 1.5% agarose gel in 1x TAE buffer. The primer list used for RT-PCR represents in Table 1. On the other hands, q-PCR was performed using the SYBR Green (TOYOBO LTD, Osaka, Japan) on the CFX connectTM real-time PCR detection system (BIO-RAD, USA) and conditions were followed: pre-denaturation for 30 sec at 95℃, denaturation for 5 sec at 95℃, annealing at a temperature specific for each primer set for 10 sec and extinction for 15 sec at 72℃ for 40 cycles. Data analysis was used to ΔΔCt method and gene expression was normalized relative to reference gene (GAPDH). The primer list used for qRT-PCR represents in Table 2.

Table 1. Reverse transcription-PCR primer lists used in this study.

GeneSequence (5’→3’)Target size (bp)References

ForwardReverse
VasaGCAGCCTTTCTCTTGCCAATCCTTTGATGGCATTCCTGGG400NM_001291682.1
Cardiac actinGTCCCCATTTACGAGGGCTATACCAATGAAGGAGGGCTGG319NM_001170517.2
NestinACCCTAAGTTGGAGCTGCATGTCCTGGTCTCTGATCTCGG245XM_005663265.2
GATA 6AAACCTGTGTGCAATGCTTGTCACCTATGTACAGCCCGTCT330XM_005656114
GAPDHTGACCCCTTCATTGACCTCCGGCTGACGATCTTGAGGGAGT343NM_001206359.1

Table 2. Quantitative real-time PCR primer lists used in this study.

GeneSequence (5’→3’)Target size (bp)References

ForwardReverse
SOX2CATGTCCCAGCACTACCAGAGAGAGAGGCAGTGTACCGTT66NM_001123197.1
NANOGCCCGAAGCATCCATTTCCAGGATGACATCTGCAAGGAGGC86DQ_447201.1
OCT-3/4GGATATACCCAGGCCGATGTGTCGTTTGGCTGAACACCTT68NM_001113060.1
GAPDHGGTCATCATCTCTGCCCCTTTCACGCCCATCACAAACATG53NM_001206359.1


Cell cycle, population doubling time and karyotyping analysis

For cell cycle analysis, Lenti-piPSCs and Sev-piPSCs were dissociated with 0.05% Trypsin/EDTA at 39℃ for 5 min. These cells digested to single cells were incubated with propidium iodide (PI) staining solution [50 µL/mL PI, 0.1 mg/mL RNase A, Triton X-100 in PBS] at 37℃ for 40 min. The samples were analyzed by using BD FACS Calibur flow cytometer (BD Biosciences, Becton Dickinson, NJ, USA) and cellquest software. Maximum excitation of PI bound to DNA was at 483 nm and emission was at 635 nm. The results were analyzed by using FlowJo software version 10.0.7 (TREE STAR Inc.). On the other hands, the population doubling time (PDT) of dissociated Lenti-piPSCs and Sev-piPSCs were calculated using the duration*log (2) /log (final concentration)-log (initial concentration) formula at each passage.

For karyotyping analysis, Lenti-piPSCs and Sev-piPSCs were cultured with 0.1 µL/mL of colcemide (Biological Industries Israel Beit Haemek LTD, Kibbutz Beit Haemek, Israel) in culture medium at 37℃ for 1 hour and then harvested using 0.05% Trypsin/EDTA. Harvested single cells were incubated with hypotonic solution (0.4% NaCl and 0.4% KCl in H2O) at 39℃ for 6 min and then fixed in fixative (3:1 = methanol:acetic acid). The cell pellet suspended in 1 mL of fixation solution was dropped onto cold slide and then dried. The chromosomes of metaphase stage stained with Giemsa were patterned by standard G-banding techniques.

In vitro differentiation

For the production of embryoid bodies (EBs), Lenti-piPSCs and Sev-piPSCs were dissociated with 0.05% Trypsin/EDTA at 39℃ for 5 min and collected in differentiation medium [DMEM/F12 supplemented with 1% MEM nonessential amino acids, 1% penicillin/streptomycin, 2 mM L-glutamine, 0.1 mM β-mercaptoethanol and 20% FBS]. Collected these cells were aggregated into EBs for 3 day in hanging drop at a seeding density of 1 × 103 cells/drop. EBs were transferred to low attachment dishes (Corning, USA) and kept in suspension for another 4 days. After 4 days, they were transferred to 0.1% gelatin solution (Millipore, Darmstadt, Germany) coated dishes with differentiation medium and medium were changed daily for 14 days.

Statistical analysis

At least three replicates were measured for each group. The statistical significance (p value) in mean values among multiple sample groups was evaluated by one way ANOVA, or two-way ANOVA with Bonferroni’s post hoc test using the Prism 4 program (GraphPad Software, San Diego, Ca, USA). Values shown on graphs represent the mean ± S.E.

RESULTS

Induction efficiency of porcine fibroblasts into porcine induced pluripotent stem cells by using Lentiviral vector

This experiment was carried out to examine the optimal induction efficiency of porcine fetal fibroblasts (PFFs) into piPSCs by using Lentiviral vectors in various culture conditions. PFFs were transduced by using Lenti-viral vectors with combinations of four (POU5F1, SOX2, KLF4, C-MYC; OSKM) or six (POU5F1, SOX2, KLF4, C-MYC, NANOG, LIN28; OSKMNL) reprogramming factors under multiplicity of infection (MOI) 25 condition for 24 h and then cultured on mitomycin C inactivated mouse embryonic fibroblasts (iMEFs) with under three culture conditions [DMEM/F12 + 20% FBS with 20 ng/mL LIF, DMEM/F12 + 20% KSR with 20 ng/mL LIF and DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF]. As shown in Table 3, colonies derived from piPSCs transduced by using six reprogramming factors (OSKMNL) at transduction (TD) 6 and 16 days were investigated in all culture conditions. However, colonies derived from piPSCs transduced by using four reprogramming factors (OSKM) were induced only in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF culture condition (Fig. 1B). In the next experiment, AP-positive (+) colonies were shown in piPSCs transduced by six reprogramming factors (OSKMNL) in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF culture condition at passage 3, 10 and 20, whereas piPSCs transduced by using four reprogramming factors (OSKM) were shown AP-negative (-) at all-time points (p < 0.0001) (Fig. 1A and 1C).

Table 3. Reprogramming efficiency of porcine fibroblasts by using Lentiviral vector in various culture conditions.

Base mediumSupplementReprogramming factors deliveredColonies obtained after TD 6 (%)Colonies obtained after TD 16 (%)AP-positive colonies at passage 3 (%)
DMEM/F12 + 20% FBSLIFOSKM
OSKMNL
0
0.1
0
1.38
0
68.3
DMEM/F12 + 20% KSRLIFOSKM
OSKMNL
0
0.09
0
1.42
0
68.0
DMEM/F12 + 10% FBS/KSRLIFOSKM
OSKMNL
0.08
0.12
1.40
1.49
0.8
97.0

Porcine fetal fibroblasts (PFFs) were reprogrammed using four (OSKM) and six (OSKMNL) human factors under multiplicity of infection (MOI) 25 condition for 24 h and then cultured on mouse embryonic feeder (MEF) cells treated with mitomycin C under three different culture conditions: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) + 20% fetal bovine serum (FBS) with 20 ng/mL leukemia inhibitor factor (LIF), DMEM/F12 + 20% knock-OutTM serum replacer (KSR) with 20 ng/mL LIF and DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF. After transduction, reprogramming efficiency was determined as the percentage of colonies formed per the number of infected cells seeded (10,000 cells). Lenti-virus induced pluripotent stem cells (Lenti-iPSCs) were identified based on embryonic stem cell (ESC)-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. Reprogramming factors delivered represents OSKM or OSKMNL combination of reprogramming factors: O, OCT 4; S, SOX2; K, KLF4; M, CMYC; N, NANOG; L, LIN28..


Figure 1.Comparison of induction efficiency between Lenti-viral vector and Sendai-viral vector. (A) Alkaline phosphatase (AP) staining of the colonies derived from transduced cells with Sendai- and Lenti-viral vectors after transduction (TD) 16 days at passage 3, 10 and 20, respectively. Scale bar = 100 µm. (B) The number of colony formation generated by Sendai-viral vectors with four reprogramming factors (POU5F1, SOX2, KLF4, C-MYC; Sev-iPSCs (OSKM)), Lenti-viral vectors with four (POU5F1, SOX2, KLF4, C-MYC; Lenti-iPSCs (OSKM) and six (POU5F1, SOX2, KLF4, C-MYC, NANOG, LIN28; Lenti-iPSCs (OSKMNL) reprogramming factors was counted after TD 6 to 16 days. (C) The percentage of AP-positive (+) colonies derived from Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10 and 20. All the values were represented as mean ± standard errors of five replicates and the impacts of each gene delivery systems (Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (10, 20 and 30) and their interactions on AP activity were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. a,bValue in same columns with different superscripts are significantly different (p < 0.0001). ns, not significant.

Induction efficiency of porcine fibroblasts into porcine induced pluripotent stem cells by using Sendaivirus vector

To examine the optimal induction efficiency of PFFs into piPSCs by using Sendai-viral vector in various culture conditions, PFFs were transduced by using Sendai-viral vector with combinations of four reprogramming factors (POU5F1, SOX2, KLF4, C-MYC; OSKM) under multiplicity of infection (MOI) 3 condition for 24 h and then cultured on iMEFs under twelve culture conditions [DMEM/F12 + 20% FBS with 20 ng/mL LIF or 4 ng/mL bFGF; DMEM/F12 + 20% KSR with 20 ng/mL LIF or 4 ng/mL bFGF; DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF or 4 ng/mL bFGF; KnockOut DMEM/F12 + 20% FBS with 20 ng/mL LIF or 4 ng/mL bFGF; KnockOut DMEM/F12 + 20% KSR with 20 ng/mL LIF or 4 ng/mL bFGF; KnockOut DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF or 4 ng/mL bFGF]. As shown in Table 4, colonies of piPSCs transduced by using Sendaiviral vectors with four reprogramming factors (OSKM) were constructed only in KnockOut DMEM/F12 + 20% KSR + 4 ng/mL bFGF culture condition after TD 6 and 16 days. However, colonies of piPSCs transduced by using the Sendaiviral vectors containing four reprogramming factors (OSKM) were not induced in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF culture condition (Fig. 1B). In the next experiment, AP-positive (+) colonies were showed in piPSCs transduced by using four reprogramming factors (OSKM) in KnockOut DMEM/F12 + 20% KSR + 4 ng/mL bFGF at all-time points (p < 0.0001) (Fig. 1A and 1C).

Table 4. Reprogramming efficiency of porcine fibroblasts by using Sendaivirus vector in various culture conditions.

Base mediumSupplementReprogramming factors deliveredColonies obtained after TD 6 (%)Colonies obtained after TD 16 (%)AP-positive colonies at passage 3 (%)
DMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0
DMEM/F12 + 20% KSRLIF
bFGF
OSKM0
0
0
0
0
0
DMEM/F12 + 10% FBS/KSRLIF
bFGF
OSKM0
0
0
0
0
0
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0.02
0
0.02
0
92.5
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0

Porcine fetal fibroblasts (PFFs) were reprogrammed using four human factors (OSKM) under multiplicity of infection (MOI) 3 condition for 24 h and then cultured on mouse embryonic feeder (MEF) cells treated with mitomycin C under twelve different culture conditions: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) + 20% fetal bovine serum (FBS) with 20 ng/mL leukemia inhibitor factor (LIF), DMEM/F12 + 20% FBS with 4 ng/mL basic fibroblast growth factor-2 (bFGF), DMEM/F12 + 20% knock-OutTM serum replacer (KSR) with 20 ng/mL LIF, DMEM/F12 + 20% KSR with 4 ng/mL bFGF, DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF, DMEM/F12 + 10% FBS/KSR with 4 ng/mL bFGF, KnockOutDMEM/F12 + 20% FBS with 20 ng/mL LIF, KnockOutDMEM/F12 + 20% FBS with 4 ng/mL bFGF, KnockOutDMEM/F12 + 20% KSR with 20 ng/mL LIF, KnockOutDMEM/F12 + 20% KSR with 4 ng/mL bFGF, KnockOutDMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF and KnockOutDMEM/F12 + 10% FBS/KSR with 4 ng/mL bFGF. After transduction, reprogramming efficiency was determined as the percentage of colonies formed per the number of infected cells seeded (100,000 cells). Sendai-virus induced pluripotent stem cells (Sev-iPSCs) were identified based on embryonic stem cell (ESC)-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. Reprogramming factors delivered represents OSKM combination of reprogramming factors: O, OCT 4; S, SOX2; K, KLF4; M, CMYC..



Comparative expression of endogenous pluripotency-associated genes in between Lenti-piPSCs and Sev-piPSCs

We evaluated the expression of endogenous pluripotency marker genes (OCT-3/4, NANOG, SOX2, KLF4, CMYC and LIN28) with different passage courses (3, 10 and 20) in previously established culture condtions [Sev-piPSCs (OSKM) cultured in KnockOut DMEM/F12 + 20% KSR with 4 ng/mL bFGF; Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) cultured in DMEM/F12 + 10% FBS/KSR + 20 ng/mL LIF] using comparative real-time PCR. There was no difference in expressions of endogenous the pluripotency-associated genes from viral transduction systems (Fig. 2A and 2B). Interestingly, expression of endogenous NANOG gene was significantly higher in Lenti-piPSCs (OSKMNL) at all-time points than as compared to PFFs, Lenti-piPSCs (OSKM) and Sev-piPSCs (OSKM) (p < 0.0001). The expression of other endogenous pluripotency-associated genes (OCT-3/4, SOX2, KLF4 and CMYC) was shown in Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL), whereas Lin28 was not detected in all piPSCs (Fig. 2B).

Figure 2.Expression of pluripotent marker genes in between Lenti-iPSCs and Sev-iPSCs. (A) Relative mRNA levels of OCT-3/4, NANOG, SOX2, KLF4, CMYC, LIN28 in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) with different passage course (3, 10 and 20). Data were normalized to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and all the values were represented as mean ± standard errors of three replicates. The impacts of each gene transduction systems (PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (3, 10 and 20) and their interactions on relative mRNA levels were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. (B) Expression analysis of pluripotency marker genes (OCT-3/4, NANOG, SOX2, KLF4, CMYC, LIN28) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10, 20 respectively.

Comparative expression of exogenous reprograming genes in between Lenti-piPSCs and Sev-piPSCs

This experiment was performed in order to examine the continuous expression of exogenous reprogramming factors in piPSCs constructed by using Sendaiviral and Lentiviral vectors. We evaluated the expression of exogenous reprogramming genes (hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) with different passage courses (3, 10 and 20) in Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) using comparative real-time PCR. There was a difference in expressions of exogenous reprogramming genes in piPSCs constructed from viral transduction systems (Fig. 3A and 3B). The expression patterns of hOCT-3/4, hNANOG, hSOX2, hKLF4 and hCMYC decreased significantly lower in Sev-piPSCs (OSKM) at all-time points than as compared to Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) (p < 0.0001). However, Lenti-piPSCs (OSKMNL) induced highly expressions of exogenous reprogramming factors (hOCT-3/4, hNANOG, hSOX2, hKLF4 and hCMYC). Interestingly, the mRNA expression of hLIN28 was not detected in all piPSCs (Fig. 3A and 3B).

Figure 3.Comparison of expression of transgene genes between Lenti-iPSCs and Sev-iPSCs. (A) Relative mRNA levels of hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28 in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) with different passage courses (3, 10 and 20). Data were normalized to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and all the values were represented as mean ± standard errors of three replicates. The impacts of each gene delivery systems (PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (3, 10 and 20) and their interactions on relative mRNA levels were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. (B) Expression analysis of transgene genes (*hOCT-3/4, *hNANOG, *hSOX2, *hKLF4, *hCMYC, *hLIN28, hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) in Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10, 20, respectively. *Primer contains woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) region within viPS lentiviral vector. Expression analysis of transgene genes (*SEV, *KOS, *KLF4, *CMYC, hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) in Sev-iPSCs (OSKM) at passage 3, 10, 20, respectively. *Primer contains SeV genome sequences.

Comparative expression of pluripotency and surface markers in Lenti-piPSCs and Sev-piPSCs

Expression of OCT-3/4, NANOG and SOX2 proteins in the colonies of Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) was relatively higher at passage 10 and 20, demonstrating that Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) expressed the core pluripotency genes (Fig. 4A). However, OCT-3/4 and SOX2 proteins in colony of Lenti-piPSCs (OSKM) were expressed at passage 10, but not expressed at passage 20. Interestingly, there was no expression of NANOG protein in Lenti-piPSCs (OSKM) at passage 10 and 20 (Fig. 4A). On the other hand, SSEA-1 was expressed in only Sev-piPSCs (OSKM), whereas SSEA-4 was expressed in only Lenti-piPSCs (OSKMNL). However, there was no expression of TRA-1-60 and TRA-1-81 in both Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL). All of surface markers was not expressed in Lenti-piPSCs (OSKM) (Fig. 4A).

Figure 4.Expression of pluripotent, surface and differentiated markers in Lenti-iPSCs and Sev-iPSCs. (A) Immunocytochemistry of pluripotency markers (OCT-3/4, NANOG and SOX2) and surface markers (SSEA-1, SSEA-4, TRA-1-60 and TRA-1-81) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 10 and 20, respectively. Inset: Immunostaining of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL), Blue is Hoechst 33342 signal and indicate nuclei. Scale bar = 50 µm. (B) Trimethylation of histone H3 at lysine 27 (H3K27me) in PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). Blue: staining of Hoechst 33342, Red: staining of H3K27me protein. Scale bar = 50 µm.

In order to examine the epigenetic mechanism of differentiation-associated gene repression at the time of conoly formation, we immunolabeled three piPSCs types (Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL)) with an antibody against trimethylation of histone H3 at lysine 27 (H3K27me3) (Fig. 4B). Expression of H3K27me3 was down-regulated in the colonies of Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL), whereas was up-regulated in PFFs and Lenti-piPSCs (OSKM).

Cell cycle phase and population doubling time in Lenti-piPSCs and Sev-piPSCs

The cell cycle of Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) was analyzed using FACS and FlowJo. The greater part of PFFs was remained at G0/G1 stage. Additionally Lenti-piPSCs (OSKM) were slightly higher in the G0/G1 stage than Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL). However, Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) were slightly increased in G2/M phase than Lenti-piPSCs (OSKM) (p < 0.05) (Fig. 5A and 5B). As shown in Fig. 5C, PDT of Lenti-piPSCs (OSKMNL) was significantly shortened than that of other groups, whereas PDT of Sev-piPSCs (OSKM) was significantly lengthened (p < 0.05).

Figure 5.Flow-cytometric analysis of cell cycle phase-specific population and population doubling time (PDT) in Lenti-iPSCs and Sev-iPSCs. (A) Cell-cycle analysis of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) was analyzed by using FACS and Flow Jo. (B) The cell cycle distribution of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and PFFs were analyzed. All the values were represented as mean ± standard errors. (C) The population doubling time (PDT) was calculated in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and PFFs. a,b,c,dValue in same columns with different superscripts are significantly different (p < 0.05) with two-way ANOVA and Bonferroni’s post-hoc test.

In vitro differentiation of Lenti-piPSCs and Sev-piPSCs

To investigate in vitro differentiation capacity of Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL), the piPSCs cultured in differentiation medium were aggregated in hanging drop at a seeding density of 1 × 103 cells/drop for 3 days. And then aggregated EBs were attached on 0.1% gelatin-coated dishes. After 14 days, attached EBs started to show the morphologies of differentiated cells (Fig. 6A). EBs aggregated from Lenti-piPSCs (OSKMNL) strongly expressed all of differentiation marker genes (GATA6, NESTIN and CARDIAC ACTIN), but slightly expressed a primordial germ cells marker (VASA). However, EBs derived from Sev-piPSCs (OSKM) and Lenti-piPSCs (OSKM) did not show the expression of CARDIAC ACTIN and VASA. Interestingly, GATA 6 as an endoderm marker was not detected in EBs derived from Sev-piPSCs (OSKM) (Fig. 6B). Finally, karyotype analysis was carried out in Sev-piPSCs (OSKM), Lenti-piPSCs (OSKM) and Lenti-piPSCs (OSKMNL) to demonstrate the presence of chromosomal normalities. Our result presented a normal chromosome content (2N = 38) in more than 70% of the examined metaphase piPSCs derived from the viral transduction systems (Fig. 6C).

Figure 6.In vitro differentiation and karyotype analysis of Lenti-iPSCs and Sev-iPSCs. (A) Changes in the morphology of embryoid bodies (EBs) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). (B) Gene expression of differentiation markers [GATA6: endoderm, NESTIN: ectoderm and CARDIAC ACTIN: mesoderm and VASA: primordial germ cells marker] in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). Scale bar = 100 µm. (C) Karyotyping indicates a normal chromosome in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) when compared with PFFs.

DISCUSSION

In the present study, we observed pluripotent characteristics of porcine induced pluripotent stem cells (piPSCs) which produced by delivering reprogramming factors with integrating Lentiviral vector and non-integrating Sendaiviral vector into the host genome. Lentivirus-mediated reprogramming is a preferentially used method for generating piPSCs because Lentiviral vector is able to integrate efficiently reprogramming factors into differentiated cell’s genome, ensuring stable and long-term expression of these factors (Ezashi et al., 2009; Kim et al., 2009). Instead, Sendaivirus-mediated reprogramming has been adapted for inducing low cytotoxicity through a type of RNA virus because the Sendaiviral vector does not integrate its reprogramming factors into the host genome unlike Lentiviruses. The ectopic reprogramming factors introduced by the Lentiviral or Sendaiviral vector induce the genetic and epigenetic changes necessary to convert the differentiated cells into pluripotent stem cells (PSCs). However, one potential problem of the methods is the risk of insertional mutagenesis, where the integration of Lentiviral DNAs into the host genome may disrupt the normal function of endogenous genes and lead to unintended genetic changes. To solve this problem, the non-integrating process may reduce the risk of genetic mutations and makes it a safer choice to produce piPSCs for research and potential therapeutic purposes in a porcine model. Therefore, the delivery of reprogramming factors using Sendai viral vectors has been considered the safest tool for inducing low cytotoxicity without inserting transgenes into the host genome.

So far, culture conditions have not been optimized to induce efficiently reprogramming and ensure the long-term stability of piPSCs depending upon the endogenous pluripotency machinery. Therefore, the effect of culture on virus-mediated reprogrammed cells is of significance for generating bona fide piPSCs. In this study, we have found that the most reliable piPSCs are generated by the integrating Lentiviral vector (Lenti-iPSCs (OSKMNL)) including specific six transcription factors (POU5F1, SOX2, KLF4, C-MYC, NANOG and LIN28) and non-integrating Sendaiviral vector (Sev-iPSCs (OSKM)) including four transcription factors (POU5F1, SOX2, KLF4 and C-MYC). After the transduction, Lenti-iPSCs (OSKMNL) cultured in DMEM/F12 + 10% FBS/KSR supplemented with 20 ng/mL of leukemia inhibitory factor (LIF) produce the highest rates of colonies and alkaline phosphatage (AP) activity. Sev-iPSCs (OSKM) survive only in KnockOut DMEM/F12 + 20% KSR with 4 ng/mL of basic fibroblast growth factor-2 (bFGF) culture condition and express positively the AP activity. However, in the case of the Lentiviral vector (Lenti-iPSCs (OSKM)) including four transcription factors (POU5F1, SOX2, KLF4 and C-MYC), few colonies were produced in DMEM/F12 + 10% FBS/KSR with 20 ng/mL of LIF culture condition after the transduction and the AP activity did short-lived.

They were previously reported that pluripotent characteristics of porcine embryonic stem cells (pESCs), porcine epiblast stem cells (pEpiSCs) and piPSCs are quite similar to humans, as evidenced the primed pluripotent state regarding gene expression patterns (Alberio et al., 2010; Telugu et al., 2010; Choi et al., 2013; Park et al., 2013; Baek et al., 2021). In this study, as pluripotent characteristics of piPSCs generated through different viral transduction systems, Lenti-iPSCs (OSKMNL) resembled the naïve mouse embryonic stem cells (mESCs) in colony morphology for culture, whereas Sev-iPSCs (OSKM) presented the primed human embryonic stem cells (hESCs). Although significant differences in expression of OCT-3/4 and NANOG during embryonic development were reported (Gao et al., 2010; Gao et al., 2011; Wolf et al., 2011), a pluripotent state is able to be induced in porcine cells overexpressing mouse or human reprogramming factors such as Oct-3/4 and NANOG. Endogenous OCT-3/4 gene of Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM) lines strongly expressed, as evidenced that OCT-3/4 mRNAs in all piPSCs lines positively expressed for culture at passage 3, 10 and 20. In mice, expression of NANOG gene in ESCs stabilizes the state of pluripotency without being a strict requirement for culture (Chambers et al., 2007). However, NANOG mRNAs were higher expressed in Lenti-iPSCs (OSKMNL) rather than Lenti-iPSCs (OSKM) and Sev-iPSCs (OSKM) for culture. Interestingly, endogenous SOX2, KLF4, C-MYC and LIN28 genes expression did not show significant differences in between three piPSCs lines at all passages.

As mentioned earlier, to produce bona fide iPSCs from differentiated cells, they include silencing of exogenous transgenic genes integrated into the host genome and then reactivating of endogenous pluripotency machinery expression on behalf of ectopic transgenes expression. in mice, ∼1% of primary fibroblasts could be efficiently reprogrammed to iPSCs using Sendaiviral vector installed with defined factors (OCT-3/4, SOX2, KLF4 and C-MYC) without chromosomal gene integration. In this study, Sev-iPSCs (OSKM) with human POU5F1, SOX2, KLF4 and C-MYC non-integration were produced using porcine fibroblasts. The expression of exogenous reprogramming factors (hOCT-3/4, hSOX2, hKLF4 and hC-MYC) decreased significantly in Sev-piPSCs (OSKM) than integrating Lentiviral vectors for culture. Interestingly, Lenti-piPSCs (OSKMNL) expressed highly exogenous reprogramming factors (hOCT-3/4, hNANOG, hSOX2, hKLF4 and hC-MYC). This result identified that the non-integration process like Sendaiviral vector induces silencing of transgenic genes and creates endogenous pluripotency machinery expression.

In the PSCs, pluripotency markers including OCT-3/4, NANOG and SOX2 could be detected but the stage-specific embryonic antigens (SSEA) or Tra cell-surface markers may express specifically relying on species. In the present study, immunocytochemistry revealed that Lenti-iPSCs (OSKMNL) displayed positive expression of the pluripotent markers and also expressed positively for surface markers (SSEA-4, Tra 1-60 and Tra 1-81) but not for SSEA-1. Like Lenti-iPSCs (OSKMNL), Sev-iPSCs (OSKM) presented positive expression of the pluripotent markers but only SSEA-1 among the surface markers was expressed. As showed the naïve mESCs type in morphology, Lenti-iPSCs (OSKM) presented expression of OCT-3/4 and SOX2 proteins at initial passage, however, a strong down-regulation of pluripotent markers (OCT-3/4, NANOG and SOX2) presented at further passages. It was previously reported that expression of OCT-3/4, in contrast to that of NANOG, varies from passage to passage in porcine pluripotent stem cells (Brevini et al., 2007). On the other hand, as the characteristics of inactive X-chromosome, the activation of trimethylation of histone H3 at lysine 27 (H3K27me3) represses transcription by preventing the binding of RNA-pol II (Plath et al., 2003). In the piPSCs, H3K27me3 of Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM) was negatively expressed when compared with differentiated cells (PFFs) and Lenti-iPSCs (OSKM), thereby exhibiting their own pluripotent characteristics.

In mice, the cell-cycle of ESCs is usually characterized by a shortened G1 phase (Savatier et al., 1996; Coronado et al., 2013). Also, the cell-cycle of hESCs has shown a very short G1 phase (2-3 hours) of an abbreviated cell-cycle (16-18 hours) (Becker et al., 2006; Becker et al., 2007; Ghule et al., 2011). However, in the present study, the proportion of cell-cycle in Lenti-iPSCs (OSKMNL) and Sev-iPSCs (OSKM) significantly decreased in G0/G1 phase but increased in G2/M phase when compared with that of the differentiated cells (PFFs). There was difference in the cell cycle of Sub G1, G0/G1, S and G2/M. These cultures showed no signs of senescence over many passages and appeared to be pluripotent as evident by their ability to form embryoid bodies (EBs). Lenti-iPSCs (OSKMNL) enhanced the reproducible ability and the efficiency of in vitro differentiation induction and strongly expressed Vasa (primordial germ cells marker), Cardiac actin (mesoderm marker), Nestin (ectoderm marker) and GATA 6 (endoderm marker) in EBs aggregated, but Sev-iPSCs (OSKM) did not express the three germ layers markers.

CONCLUSION

Taken together, we have produced different porcine iPSCs lines by delivering transcription factors with integrating Lentiviral and non-integrating Sendaiviral vectors. These results suggested that the delivery system of reprogramming factors using Sendai viral vectors induces low cytotoxicity without inserting transgenes into the host genome, but Lenti-iPSCs (OSKMNL) line produced with integrating Lenti-viral vectors including six reprogramming presents the naïve mESCs type in colony morphology and pluripotent markers expression and in vitro differentiation. These results indicate that the viral transduction system of reprograming factors into porcine differentiated cells shows different pluripotency characteristics in piPSCs.

Acknowledgements

None.

Author Contributions

Conceptualization, S-K.B., I-W.L. and J-H.L.; investigation, Y-J.L. and B-G.S.; methodology, T-S.K.; project administration, J-H.L.; resources, J-W.C. and J-H.L.; supervision, C.H. and J-H.L.; writing - original draft, S-K.B. and I-W.L.; writing - review & editing, C.H. and J-H.L.

Funding

This work was supported by the National Research Foundation of Korea funded by the Korean Government (2020R1l1A3072689) Republic of Korea. In-Won Lee, Yeon-Ji Lee and Bo-Gyeong Seo were supported by the scholarship from the BK21Plus Program, Ministry of Education, Republic of Korea.

Ethical Approval

Not applicable.

Consent to Participate

Not applicable.

Consent to Publish

Not applicable.

Availability of Data and Materials

Not applicable.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig 1.

Figure 1.Comparison of induction efficiency between Lenti-viral vector and Sendai-viral vector. (A) Alkaline phosphatase (AP) staining of the colonies derived from transduced cells with Sendai- and Lenti-viral vectors after transduction (TD) 16 days at passage 3, 10 and 20, respectively. Scale bar = 100 µm. (B) The number of colony formation generated by Sendai-viral vectors with four reprogramming factors (POU5F1, SOX2, KLF4, C-MYC; Sev-iPSCs (OSKM)), Lenti-viral vectors with four (POU5F1, SOX2, KLF4, C-MYC; Lenti-iPSCs (OSKM) and six (POU5F1, SOX2, KLF4, C-MYC, NANOG, LIN28; Lenti-iPSCs (OSKMNL) reprogramming factors was counted after TD 6 to 16 days. (C) The percentage of AP-positive (+) colonies derived from Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10 and 20. All the values were represented as mean ± standard errors of five replicates and the impacts of each gene delivery systems (Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (10, 20 and 30) and their interactions on AP activity were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. a,bValue in same columns with different superscripts are significantly different (p < 0.0001). ns, not significant.
Journal of Animal Reproduction and Biotechnology 2023; 38: 275-290https://doi.org/10.12750/JARB.38.4.275

Fig 2.

Figure 2.Expression of pluripotent marker genes in between Lenti-iPSCs and Sev-iPSCs. (A) Relative mRNA levels of OCT-3/4, NANOG, SOX2, KLF4, CMYC, LIN28 in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) with different passage course (3, 10 and 20). Data were normalized to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and all the values were represented as mean ± standard errors of three replicates. The impacts of each gene transduction systems (PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (3, 10 and 20) and their interactions on relative mRNA levels were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. (B) Expression analysis of pluripotency marker genes (OCT-3/4, NANOG, SOX2, KLF4, CMYC, LIN28) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10, 20 respectively.
Journal of Animal Reproduction and Biotechnology 2023; 38: 275-290https://doi.org/10.12750/JARB.38.4.275

Fig 3.

Figure 3.Comparison of expression of transgene genes between Lenti-iPSCs and Sev-iPSCs. (A) Relative mRNA levels of hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28 in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) with different passage courses (3, 10 and 20). Data were normalized to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and all the values were represented as mean ± standard errors of three replicates. The impacts of each gene delivery systems (PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL)), passage course (3, 10 and 20) and their interactions on relative mRNA levels were assessed by the two-way ANOVA and Bonferroni’s post-hoc test. ns, not significant. (B) Expression analysis of transgene genes (*hOCT-3/4, *hNANOG, *hSOX2, *hKLF4, *hCMYC, *hLIN28, hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) in Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 3, 10, 20, respectively. *Primer contains woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) region within viPS lentiviral vector. Expression analysis of transgene genes (*SEV, *KOS, *KLF4, *CMYC, hOCT-3/4, hNANOG, hSOX2, hKLF4, hCMYC and hLIN28) in Sev-iPSCs (OSKM) at passage 3, 10, 20, respectively. *Primer contains SeV genome sequences.
Journal of Animal Reproduction and Biotechnology 2023; 38: 275-290https://doi.org/10.12750/JARB.38.4.275

Fig 4.

Figure 4.Expression of pluripotent, surface and differentiated markers in Lenti-iPSCs and Sev-iPSCs. (A) Immunocytochemistry of pluripotency markers (OCT-3/4, NANOG and SOX2) and surface markers (SSEA-1, SSEA-4, TRA-1-60 and TRA-1-81) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) at passage 10 and 20, respectively. Inset: Immunostaining of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL), Blue is Hoechst 33342 signal and indicate nuclei. Scale bar = 50 µm. (B) Trimethylation of histone H3 at lysine 27 (H3K27me) in PFFs, Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). Blue: staining of Hoechst 33342, Red: staining of H3K27me protein. Scale bar = 50 µm.
Journal of Animal Reproduction and Biotechnology 2023; 38: 275-290https://doi.org/10.12750/JARB.38.4.275

Fig 5.

Figure 5.Flow-cytometric analysis of cell cycle phase-specific population and population doubling time (PDT) in Lenti-iPSCs and Sev-iPSCs. (A) Cell-cycle analysis of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) was analyzed by using FACS and Flow Jo. (B) The cell cycle distribution of Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and PFFs were analyzed. All the values were represented as mean ± standard errors. (C) The population doubling time (PDT) was calculated in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM), Lenti-iPSCs (OSKMNL) and PFFs. a,b,c,dValue in same columns with different superscripts are significantly different (p < 0.05) with two-way ANOVA and Bonferroni’s post-hoc test.
Journal of Animal Reproduction and Biotechnology 2023; 38: 275-290https://doi.org/10.12750/JARB.38.4.275

Fig 6.

Figure 6.In vitro differentiation and karyotype analysis of Lenti-iPSCs and Sev-iPSCs. (A) Changes in the morphology of embryoid bodies (EBs) in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). (B) Gene expression of differentiation markers [GATA6: endoderm, NESTIN: ectoderm and CARDIAC ACTIN: mesoderm and VASA: primordial germ cells marker] in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL). Scale bar = 100 µm. (C) Karyotyping indicates a normal chromosome in Sev-iPSCs (OSKM), Lenti-iPSCs (OSKM) and Lenti-iPSCs (OSKMNL) when compared with PFFs.
Journal of Animal Reproduction and Biotechnology 2023; 38: 275-290https://doi.org/10.12750/JARB.38.4.275

Table 1 . Reverse transcription-PCR primer lists used in this study.

GeneSequence (5’→3’)Target size (bp)References

ForwardReverse
VasaGCAGCCTTTCTCTTGCCAATCCTTTGATGGCATTCCTGGG400NM_001291682.1
Cardiac actinGTCCCCATTTACGAGGGCTATACCAATGAAGGAGGGCTGG319NM_001170517.2
NestinACCCTAAGTTGGAGCTGCATGTCCTGGTCTCTGATCTCGG245XM_005663265.2
GATA 6AAACCTGTGTGCAATGCTTGTCACCTATGTACAGCCCGTCT330XM_005656114
GAPDHTGACCCCTTCATTGACCTCCGGCTGACGATCTTGAGGGAGT343NM_001206359.1

Table 2 . Quantitative real-time PCR primer lists used in this study.

GeneSequence (5’→3’)Target size (bp)References

ForwardReverse
SOX2CATGTCCCAGCACTACCAGAGAGAGAGGCAGTGTACCGTT66NM_001123197.1
NANOGCCCGAAGCATCCATTTCCAGGATGACATCTGCAAGGAGGC86DQ_447201.1
OCT-3/4GGATATACCCAGGCCGATGTGTCGTTTGGCTGAACACCTT68NM_001113060.1
GAPDHGGTCATCATCTCTGCCCCTTTCACGCCCATCACAAACATG53NM_001206359.1

Table 3 . Reprogramming efficiency of porcine fibroblasts by using Lentiviral vector in various culture conditions.

Base mediumSupplementReprogramming factors deliveredColonies obtained after TD 6 (%)Colonies obtained after TD 16 (%)AP-positive colonies at passage 3 (%)
DMEM/F12 + 20% FBSLIFOSKM
OSKMNL
0
0.1
0
1.38
0
68.3
DMEM/F12 + 20% KSRLIFOSKM
OSKMNL
0
0.09
0
1.42
0
68.0
DMEM/F12 + 10% FBS/KSRLIFOSKM
OSKMNL
0.08
0.12
1.40
1.49
0.8
97.0

Porcine fetal fibroblasts (PFFs) were reprogrammed using four (OSKM) and six (OSKMNL) human factors under multiplicity of infection (MOI) 25 condition for 24 h and then cultured on mouse embryonic feeder (MEF) cells treated with mitomycin C under three different culture conditions: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) + 20% fetal bovine serum (FBS) with 20 ng/mL leukemia inhibitor factor (LIF), DMEM/F12 + 20% knock-OutTM serum replacer (KSR) with 20 ng/mL LIF and DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF. After transduction, reprogramming efficiency was determined as the percentage of colonies formed per the number of infected cells seeded (10,000 cells). Lenti-virus induced pluripotent stem cells (Lenti-iPSCs) were identified based on embryonic stem cell (ESC)-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. Reprogramming factors delivered represents OSKM or OSKMNL combination of reprogramming factors: O, OCT 4; S, SOX2; K, KLF4; M, CMYC; N, NANOG; L, LIN28..


Table 4 . Reprogramming efficiency of porcine fibroblasts by using Sendaivirus vector in various culture conditions.

Base mediumSupplementReprogramming factors deliveredColonies obtained after TD 6 (%)Colonies obtained after TD 16 (%)AP-positive colonies at passage 3 (%)
DMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0
DMEM/F12 + 20% KSRLIF
bFGF
OSKM0
0
0
0
0
0
DMEM/F12 + 10% FBS/KSRLIF
bFGF
OSKM0
0
0
0
0
0
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0.02
0
0.02
0
92.5
KnockOutDMEM/F12 + 20% FBSLIF
bFGF
OSKM0
0
0
0
0
0

Porcine fetal fibroblasts (PFFs) were reprogrammed using four human factors (OSKM) under multiplicity of infection (MOI) 3 condition for 24 h and then cultured on mouse embryonic feeder (MEF) cells treated with mitomycin C under twelve different culture conditions: Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) + 20% fetal bovine serum (FBS) with 20 ng/mL leukemia inhibitor factor (LIF), DMEM/F12 + 20% FBS with 4 ng/mL basic fibroblast growth factor-2 (bFGF), DMEM/F12 + 20% knock-OutTM serum replacer (KSR) with 20 ng/mL LIF, DMEM/F12 + 20% KSR with 4 ng/mL bFGF, DMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF, DMEM/F12 + 10% FBS/KSR with 4 ng/mL bFGF, KnockOutDMEM/F12 + 20% FBS with 20 ng/mL LIF, KnockOutDMEM/F12 + 20% FBS with 4 ng/mL bFGF, KnockOutDMEM/F12 + 20% KSR with 20 ng/mL LIF, KnockOutDMEM/F12 + 20% KSR with 4 ng/mL bFGF, KnockOutDMEM/F12 + 10% FBS/KSR with 20 ng/mL LIF and KnockOutDMEM/F12 + 10% FBS/KSR with 4 ng/mL bFGF. After transduction, reprogramming efficiency was determined as the percentage of colonies formed per the number of infected cells seeded (100,000 cells). Sendai-virus induced pluripotent stem cells (Sev-iPSCs) were identified based on embryonic stem cell (ESC)-like morphology, and alkaline phosphatase (AP) staining was used to facilitate the identified cation of iPSCs colonies. Reprogramming factors delivered represents OSKM combination of reprogramming factors: O, OCT 4; S, SOX2; K, KLF4; M, CMYC..


References

  1. Alberio R, Allegrucci C. 2010. Pig epiblast stem cells depend on activin/nodal signaling for pluripotency and self-renewal. Stem Cells Dev. 19:1627-1636.
    Pubmed KoreaMed CrossRef
  2. Baek SK, Jeon SB, Seo BG, Hwangbo C, Shin KC, Choi JW, An CS, Jeong MA, Lee JH. 2021. The presence or absence of alkaline phosphatase activity to discriminate pluripotency characteristics in porcine epiblast stem cell-like cells. Cell. Reprogram. 23:221-238.
    Pubmed CrossRef
  3. Becker KA, Ghule PN, Therrien JA, Lian JB, Stein JL, Stein GS. 2006. Self-renewal of human embryonic stem cells is supported by a shortened G1 cell cycle phase. J. Cell. Physiol. 209:883-893.
    Pubmed CrossRef
  4. Becker KA, Stein JL, Lian JB, Stein GS. 2007. Establishment of histone gene regulation and cell cycle checkpoint control in human embryonic stem cells. J. Cell. Physiol. 210:517-526.
    Pubmed CrossRef
  5. Brevini TA, Tosetti V, Crestan M, Gandolfi F. 2007. Derivation and characterization of pluripotent cell lines from pig embryos of different origins. Theriogenology 67:54-63.
    Pubmed CrossRef
  6. Chambers I, Silva J, Colby D, Nichols J, Nijmeijer B, Robertson M, Vrana J, Jones K, Smith A. 2007. Nanog safeguards pluripotency and mediates germline development. Nature 450:1230-1234.
    Pubmed CrossRef
  7. Choi KH, Park JK, Kim HS, Uh KJ, Lee CK. 2013. Epigenetic changes of lentiviral transgenes in porcine stem cells derived from embryonic origin. PLoS One 8:e72184.
    Pubmed KoreaMed CrossRef
  8. Coronado D, Godet M, Bourillot PY, Tapponnier Y, Bernat A, Petit M, Afanassieff M, Markossian S, Malashicheva A, Iacone R, Savatier P. 2013. A short G1 phase is an intrinsic determinant of naïve embryonic stem cell pluripotency. Stem Cell Res. 10:118-131.
    Pubmed CrossRef
  9. Dahéron L, Opitz SL, Zaehres H, Lensch MW, Andrews PW, Daley GQ. 2004. LIF/STAT3 signaling fails to maintain self-renewal of human embryonic stem cells. Stem Cells 22:770-778.
    Pubmed CrossRef
  10. Esteban MA, Xu J, Yang J, Peng M, Qin D, Li W, Jiang Z, Chen J, Deng K, Zhong M, Cai J, Pei D. 2009. Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J. Biol. Chem. 284:17634-17640.
    Pubmed KoreaMed CrossRef
  11. Ezashi T, Telugu BP, Alexenko AP, Sachdev S, Roberts RM. 2009. Derivation of induced pluripotent stem cells from pig somatic cells. Proc. Natl. Acad. Sci. U. S. A. 106:10993-10998.
    Pubmed KoreaMed CrossRef
  12. Ezashi T, Roberts RM. 2012. Induced pluripotent stem cells from pigs and other ungulate species: an alternative to embryonic stem cells? Reprod. Domest. Anim. 47 Suppl 4:92-97.
    Pubmed CrossRef
  13. Gao Y, Hall VJ. 2010. Regulation of H3K27me3 and H3K4me3 during early porcine embryonic development. Mol. Reprod. Dev. 77:540-549.
    Pubmed CrossRef
  14. Gao Y, Jammes H, Rasmussen MA, Oestrup O, Beaujean N, Hyttel P. 2011. Epigenetic regulation of gene expression in porcine epiblast, hypoblast, trophectoderm and epiblast-derived neural progenitor cells. Epigenetics 6:1149-1161.
    Pubmed CrossRef
  15. Ghule PN, Medina R, Lengner CJ, Mandeville M, Qiao M, Dominski Z, Lian JB, Stein JL, Stein GS. 2011. Reprogramming the pluripotent cell cycle: restoration of an abbreviated G1 phase in human induced pluripotent stem (iPS) cells. J. Cell. Physiol. 226:1149-1156.
    Pubmed KoreaMed CrossRef
  16. Henderson JK, Draper JS, Baillie HS, Fishel S, Thomson JA, Andrews PW. 2002. Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens. Stem Cells 20:329-337.
    Pubmed CrossRef
  17. Jaenisch R and Young R. 2008. Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132:567-582.
    Pubmed KoreaMed CrossRef
  18. Kim D, Kim CH, Moon JI, Chung YG, Chang MY, Han BS, Ko S, Yang E, Cha KY, Kim KS. 2009. Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell 4:472-476.
    Pubmed KoreaMed CrossRef
  19. Lee IW, Lee HG, Moon DK, Lee YJ, Seo BG, Baek SK, Kim TS, Lee JH. 2023. Limited in vitro differentiation of porcine induced pluripotent stem cells into endothelial cells. J. Anim. Reprod. Biotechnol. 38:109-120.
    CrossRef
  20. Müller R and Lengerke C. 2009. Patient-specific pluripotent stem cells: promises and challenges. Nat. Rev. Endocrinol. 5:195-203.
    Pubmed CrossRef
  21. Park IH, Lerou PH, Zhao R, Daley GQ. 2008a. Generation of human-induced pluripotent stem cells. Nat. Protoc. 3:1180-1186.
    Pubmed CrossRef
  22. Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, Lerou PH, Daley GQ. 2008b. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451:141-146.
    Pubmed CrossRef
  23. Park JK, Kim HS, Uh KJ, Choi KH, Kim HM, Lee T, Yang BC, Kim HJ, Ka HH, Lee CK. 2013. Primed pluripotent cell lines derived from various embryonic origins and somatic cells in pig. PLoS One 8:e52481.
    Pubmed KoreaMed CrossRef
  24. Plath K, Fang J, Mlynarczyk-Evans SK, Cao R, Worringer KA, Wang H, de la Cruz CC, Otte AP, Zhang Y. 2003. Role of histone H3 lysine 27 methylation in X inactivation. Science 300:131-135.
    Pubmed CrossRef
  25. Romito A and Cobellis G. 2016. Pluripotent stem cells: current understanding and future directions. Stem Cells Int. 2016:9451492.
    Pubmed KoreaMed CrossRef
  26. Savatier P, Lapillonne H, van Grunsven LA, Samarut J. 1996. Withdrawal of differentiation inhibitory activity/leukemia inhibitory factor up-regulates D-type cyclins and cyclin-dependent kinase inhibitors in mouse embryonic stem cells. Oncogene 12:309-322.
  27. Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Rogers D. 1988. Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336:688-690.
    Pubmed CrossRef
  28. Takahashi K and Yamanaka S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676.
    Pubmed CrossRef
  29. Telugu BP, Roberts RM. 2010. Porcine induced pluripotent stem cells analogous to naïve and primed embryonic stem cells of the mouse. Int. J. Dev. Biol. 54:1703-1711.
    Pubmed KoreaMed CrossRef
  30. Tomioka I, Maeda T, Shimada H, Kawai K, Okada Y, Igarashi H, Oiwa R, Iwasaki T, Aoki M, Kimura T, Shiozawa S, Shinohara H, Suemizu H, Okano H. 2010. Generating induced pluripotent stem cells from common marmoset (Callithrix jacchus) fetal liver cells using defined factors, including Lin28. Genes Cells 15:959-969.
    Pubmed KoreaMed CrossRef
  31. Vallier L, Touboul T, Brown S, Cho C, Bilican B, Alexander M, Cedervall J, Chandran S, Ahrlund-Richter L, Pedersen RA. 2009. Signaling pathways controlling pluripotency and early cell fate decisions of human induced pluripotent stem cells. Stem Cells 27:2655-2666.
    Pubmed CrossRef
  32. Wolf XA, Rasmussen MA, Schauser K, Jensen AT, Hyttel P. 2011. OCT4 expression in outgrowth colonies derived from porcine inner cell masses and epiblasts. Reprod. Domest. Anim. 46:385-392.
    Pubmed CrossRef
  33. Wu Y, Chan CW, Nicholls JM, Liao S, Wu EX. 2009. MR study of the effect of infarct size and location on left ventricular functional and microstructural alterations in porcine models. J. Magn. Reson. Imaging 29:305-312.
    Pubmed CrossRef
  34. Ying QL, Nichols J, Smith A. 2003. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115:281-292.
    Pubmed CrossRef
  35. Zhang X and Godbey WT. 2006. Viral vectors for gene delivery in tissue engineering. Adv. Drug Deliv. Rev. 58:515-534.
    Pubmed CrossRef

JARB Journal of Animal Reproduction and Biotehnology

qr code

OPEN ACCESS pISSN: 2671-4639
eISSN: 2671-4663