Platelet-derived growth factor receptor alpha (PDGFRα), a member of the receptor tyrosine kinase family, activates key intracellular signaling cascades when stimulated by PDGF ligands. These ligands and their receptors, such as PDGFRα and PDGFRβ, are essential for developmental processes such as proliferation, survival, migration, and differentiation (Hoch and Soriano, 2003). In particular, PDGFA and PDGFRα play significant roles in embryonic development, including vascular patterning, testicular streak formation, sex-specific cell proliferation, endothelial cell migration, and differentiation of fetal Leydig cells (Gnessi et al., 2000; Brennan et al., 2003; Li et al., 2023).

The testes consist of seminiferous tubules and interstitial cells, notably Leydig cells. Seminiferous tubules house germ cells and somatic cells, including Sertoli cells and peritubular myocytes (Fujisawa, 2006). Sertoli and germ cells form the structural basis of the tubules, which are encircled by peritubular myoid cells (PMCs). Leydig cells, along with endothelial cells, macrophages, fibroblasts, and other interstitial cells, reside between the seminiferous tubules. These diverse testicular cells are crucial for male reproductive health, with each cell type playing a specific role while collaboratively maintaining testicular functions (Fujisawa, 2006).

PDGFRα is known to be primarily located in the interstitial mesenchymal cells of the fetal testis, while its ligand, PDGFA, is abundantly expressed and secreted by the Sertoli cells. This PDGFA-PDGFRα interaction facilitates vital physiological functions within the testis, highlighting the coordinated activity between these cells (Gnessi et al., 2000; Brennan et al., 2003; Li et al., 2023). In PDGFRα knockout mice, the number of fetal Leydig cells (FLCs) is reduced, with noticeable abnormalities, and adult Leydig cells (ALCs) fail to differentiate (Gnessi et al., 2000; Brennan et al., 2003; Li et al., 2023). PDGFRα is found in mice and rats’ fetal and postnatal mesenchyme (Gnessi et al., 1995; Gnessi et al., 2000). PMCs initially express PDGFRα in rats, but this expression is lost by day 15 post-birth (Gnessi et al., 1995). A more recent study has also documented the presence of PDGFRα in peritubular and interstitial cells in mice as early as postnatal day 6 (Malolina et al., 2022).

While PDGFRα expression in the fetal testis is well-documented, its patterns in adult testicular cells are less explored. This study aims to examine PDGFRα expression in the adult testis using mice genetically engineered to express PDGFRα with green fluorescence.

Animal

Five heterozygous PDGFRα^EGFP males (B6.129S4-Pdgfra^{tm11(EGFP)Sor}/J mice, Stock No. 007669, aged 6-7 weeks) along with five wild-type (WT) females of the same age were procured from the Jackson Laboratory (Bar Harbor, ME, USA). The PDGFRα^EGFP line expresses an H2B-eGFP fusion gene driven by the native Pdgfra promoter, leading to fluorescence that reflects the endogenous PDGFRα’s expression pattern. Homozygous expression of this gene results in embryonic lethality; hence breeding was restricted to heterozygous PDGFRα^EGFP males mated with WT females to avoid the lethality and to produce viable offspring for genotyping and experimental use. For this particular study, six 12-week-old heterozygous PDGFRα^EGFP males were used. Five WT male mice of the C57BL/6 strain, aged 12 weeks, were sourced from Central Lab. Animal Inc. (Seoul, South Korea). These mice were housed under specific-pathogen-free conditions with a consistent 12-hour light-dark cycle at a temperature between 20-24℃ and a humidity of 50-60%. They had continuous access to food and sterile water. All animal experiments were conducted in compliance with the ethical standards set by the Gyeongsang National University Animal Care and Use Committee, under the approved protocols GNU-200702-M0041 for WT mice and GNU-230927-M0184 for PDGFRα^EGFP mice.

Genotyping

Genotyping of PDGFRα^EGFP mice was conducted using genomic DNA extracted from ear tissue punches at three weeks of age. Genomic DNA extraction and PCR analysis were performed using the Phire^TM Tissue Direct PCR Master Mix (Thermo Fisher Scientific Baltics UAB, Cat# F-170S, Vilnius, Lithuania). Ear tissue was suspended in 20 µL of dilution buffer containing 0.5 µL of DNA release additive provided in the kit. This mixture underwent a 2-minute incubation at room temperature and a 2-minute incubation at 98℃. Then, 0.5 µL of the prepared genomic DNA was combined with Phire Tissue Direct PCR Master Mix (2X) and specific primers (F, Rw, and Rm). The PCR conditions were as follows: initial denaturation at 98℃ for 5 min, followed by 40 cycles of 98℃ for 5 sec, 60℃ for 5 sec, and 72℃ for 30 sec, concluding with a final extension at 72℃ for 5 min. The PCR products were electrophoresed on a 1.5% (w/v) agarose gel to verify the product size. Images of the DNA fragments were captured directly using the iBright^TM CL1500 Imaging System (Thermo Scientific Fisher/Life Technologies Holdings Pte Ltd., Singapore). Primer sequences are listed in Table 1.

Table 1. Pdgfra^{tm11(EGFP)Sor}/J mice genotyping primer sequences.

Gene name	Species	Genotype	Primer sequences (5’–3’)	Application	Expected size (bp)
Pdgfra	Mouse	Wild	F1: CCCTTGTGGTCATGCCAAAC	Genotyping	451
			Rw: GCT TTTGCCTCCATTACACTGG
		Mutant	F1: CCCTTGTGGTCATGCCAAAC	Genotyping	242
			Rm: ACGAAGTTATTAGGTCCCTCGAC

Hematoxylin and eosin (H&E) staining

Histological analysis of testicular tissue was conducted using hematoxylin and eosin (H&E) staining, following the method outlined by Siregar (Siregar et al., 2019). Testicular sections prepared from tissues fixed in 4% paraformaldehyde overnight at 4℃ were sequentially submerged in increasing concentrations of sucrose (10% to 30%). The tissues were then embedded in Tissue-Tek® OCT compound (Sakura Finetek, Torrance, CA, USA) and sectioned at 10 µm thickness using a cryostat. Sections were air-dried on gelatin-coated slides and briefly rinsed with distilled water. The sections were stained with hematoxylin for one minute and then with eosin for five minutes. Subsequently, the sections underwent a graded series of ethanol dehydration (70% to 100% ethanol, three minutes each) and cleared in xylene. The slides were mounted using a permount mounting medium (Fisher Chemical, Geel, Belgium) and examined under an Olympus BX61VS microscope (Tokyo, Japan) to capture images. Consistency was verified by analyzing five different sections from each sample.

Immunohistochemistry (IHC)

Cryostat-prepared tissue sections were permeabilized using 0.2% Triton X-100 for 10 minutes at room temperature. After three washes with PBS, the sections were blocked for 60 min at room temperature using a 1% normal goat serum in 0.1 M PBS. The sections were then incubated overnight at 4℃ with primary antibodies, each diluted 1:100: anti-mouse TMEM16A (ANO1, monoclonal antibody, Santa Cruz Biotechnology, Dallas, TX, USA), Alexa Fluor® 594 anti-mouse CD117 (c-Kit, Biolegend, San Diego, CA, USA), D1E1E XP® rabbit monoclonal antibody against PDGFRα (Cell Signaling Technology, Danvers, MA, USA), and anti-rabbit KCNK3 (TASK-1, polyclonal antibody, Alomone Labs^TM, Jerusalem, Israel).

Following primary incubation, the sections were treated with either Alexa Fluor^TM Plus 488 or Alexa Fluor^TM Plus 594 anti-rabbit IgG secondary antibodies (Thermo Fisher Scientific, Waltham, MA, USA), both diluted 1:100 in PBS, for 1.5 hours in the dark, interspersed with three PBS washes. Nuclei were then stained with 4’,6’-diamidino-2-phenylindole (DAPI). The sections were mounted using Gel/Mount^TM (Biomeda Corp., Foster City, CA, USA) and analyzed under a confocal laser scanning microscope (Olympus, Tokyo, Japan).

Genotyping of PDGFRα^EGFP mice

The PDGFRα^EGFP mice are genetically engineered to express a histone H2B-enhanced Green Fluorescent Protein (eGFP) fusion gene under the control of the endogenous Pdgfrα promoter. Genotyping PCR and subsequent gel electrophoresis were performed to determine the zygosity of these mice. As shown in Fig. 1, the gel image for the WT allele shows a distinct single band at approximately 450 bp, which aligns with the expected product size of 451 bp for the WT allele, as listed in Table 1. In contrast, lanes labeled as Heterozygote display two bands, one at approximately 450 bp and a second at around 250 bp, corresponding to the WT and mutant alleles, respectively, with the mutant allele having an expected size of 242 bp. This dual-band pattern confirms the heterozygous genotype of these mice. Heterozygotes were selected for subsequent studies as homozygous for this knock-in targeted mutation, which has an embryonic lethal phenotype.

Figure 1.Genotyping of B6.129S4-Pdgfra^{tm11(EGFP)Sor}/J mice (PDGFRα^EGFP). Agarose gel electrophoresis of PCR products showing genotyping results for wild-type (WT) and heterozygous mice. The DNA ladder on the left indicates fragment sizes in base pairs (bp), with relevant bands at 500 and 200 bp. The WT samples show a single band consistent with the WT allele, while heterozygote samples exhibit two bands, indicating the presence of both the wild-type and mutant alleles.

Identification of PDGFRα in PDGFRα^EGFP mouse testicular tissue

In the PDGFRα^EGFP mouse model, H&E staining of cryostat sections confirmed typical testicular tissue morphology. Seminiferous tubules were adequately structured, with the expected presence of spermatogenic cells, Sertoli cells, Leydig cells, and PMCs, without any detectable pathological changes (Fig. 2A, n = 3). Fluorescence imaging allowed for the visualization of PDGFRα positive (PDGFRα⁺) cells marked by eGFP, which were prominently situated in the interstitial spaces of the testis (Fig. 2B, n = 6). Further examination of magnified images revealed the specific localization of PDGFRα cells within PMCs, indicated by red arrows, and Leydig cells, denoted by yellow arrows (Fig. 2C). In the WT mouse testicular tissue, co-localization of α-SMA, indicative of myoid cells, with PDGFRα⁺ cells identified using their antibodies, was observed as a yellow hue. The colocalized cells appear to be PMCs (red arrow). In addition, PDGFRα immunostaining was apparent in Leydig cells (yellow arrow, Fig. 2D).

Figure 2.Analysis of testicular tissue sections of PDGFRα^EGFP mice. (A) Hematoxylin and Eosin (H&E) staining depicts typical seminiferous tubule architecture with visible spermatogenic, Sertoli and Leydig cells. (B) Fluorescent imaging of testicular tissue of PDGFRα^EGFP mice. DAPI staining highlights nuclei within the testicular tissue. (C) Magnified fluorescent imaging shows PDGFRα-positive cells (green) in the interstitial space with specific localization in peritubular myoid cells (PMCs, red arrow) and Leydig cells (yellow arrow). (D) From left to right, DAPI nuclear staining, α-SMA cytoskeletal staining in PMCs, PDGFRα staining in interstitial cells, combined staining of α-SMA/PDGFRα/DAPI, and Differential Interference Contrast (DIC) microscopy for tissue structure visualization. The co-localization of α-SMA and PDGFRα (indicated by the overlay of green and red resulting in yellow) suggests the presence of both markers in the same cells. Scale bars, 100 μm.

Localization of c-Kit, ANO-1, and TASK1 in PDGFRα⁺ cells

Immunohistochemical analysis showed c-Kit expression in PDGFRα⁺ cells, specifically within Leydig cells and PMCs (Fig. 3A, n = 4). Erythrocytes also exhibited a marked expression of c-Kit, marked by a white arrowhead in Fig. 3A. ANO-1 expression patterns paralleled those of c-Kit, colocalizing with PDGFRα⁺ cells and showing even stronger expression in erythrocytes compared to PDGFRα levels (Fig. 3B, n = 4). Furthermore, the tandem of pore domains in a weakly inward rectifying K⁺ channel (TWIK)-related acid-sensitive K⁺ (TASK)-1 was present in both Leydig cells and PMCs and approximately 80% colocalized with PDGFRα (Fig. 3C, n = 4).

Figure 3.Immunofluorescence staining of testicular tissue sections of PDGFRα^EGFP mice. (A) Co-localization of PDGFRα (green) and c-Kit (red). Their co-localization appears as yellow. The merged image also includes differential interference contrast (DIC) to visualize cell structure. (B) Similar staining pattern with DAPI, PDGFRα, and ANO-1 (red), showing co-localization of PDGFRα and ANO-1 (yellow) in the merged panel. (C) DAPI staining, PDGFRα, and TASK-1 (red) expression. TASK-1 and PDGFRα co-localization is indicated in yellow. The rightmost panels for each row depict DIC images corresponding to the fluorescent images. Bar graphs depict the percentage of co-localization for each marker with PDGFRα⁺ cells. Each bar represents the mean ± SD for four samples. Scale bar, 50 μm.

Our investigation into the expression of PDGFRα in testicular tissue of PDGFRα^EGFP mice has provided detailed insights into its localization and potential functions. The maintenance of typical testicular morphology, as demonstrated by H&E staining, along with the presence of various cell types critical to spermatogenesis and hormonal regulation, sets the stage for a deeper understanding of PDGFRα’s role in testicular function. The distinct visualization of PDGFRα⁺ cells in the interstitial spaces, specifically colocalizing PMC and Leydig cells, as highlighted by eGFP expression, points to PDGFRα’s involvement in the testicular microenvironment. PDGFRα⁺ cells are engineered to express eGFP in the nucleus (Ha et al., 2017). Its co-localization with α-SMA further emphasizes its role in the structural and possibly functional aspects of myoid cells, which are integral to the integrity and contractility of the seminiferous tubules (Kawabe et al., 2022).

PDGFRα exhibits broad expression across mesenchymal tissues, including the testis, and serves distinct roles in various organs (Li et al., 2018). In the mouse testis, Sertoli, PMCs, and Leydig cells are the primary somatic types, distinguished by morphology and specific immunostaining markers. However, such markers are not exclusively specific, including 3βHSD for Leydig cells and α-SMA for PMCs (Aksel et al., 2023). We opted for other Leydig cell markers, such as c-Kit and ANO-1, identified in previous studies (Ko et al., 2022; Woo et al., 2023). PDGFRα is a recognized marker for FLC (Lee et al., 2024), and our findings align with prior research indicating PDGFRα’s presence in Leydig cells and PMCs, but its absence in germ cells, Sertoli cells, and vascular endothelial cells (Zhao et al., 2021). Stem Leydig cells differentiate into testosterone-producing Leydig cells under PDGFAA and luteinizing hormone and transform into PMCs in response to PDGFBB and TGFβ (Zhao et al., 2021), illustrating the effect of the microenvironment on cell differentiation. Given PDGFRα’s activation by various PDGF ligands, it is inferred that the expression of PDGFRα in Leydig cells and PMCs is likely to play a role in response to PDGF signals (Mariani et al., 2002). Our study highlights PDGFRα expression in 11-week-old mouse Leydig cells, which had previously been identified only in FLC, and prompts further investigation of its physiological functions.

In the gastrointestinal system, PDGFRα⁺ cells have distinct functions from c-Kit⁺ interstitial cells of Cajal (ICC), forming electrical synapses with ICCs and smooth muscle cells to regulate motility (Kurahashi et al., 2012). However, in the testis, the co-expression of both markers in a single cell may represent an integration of the functions of each protein. The observed c-Kit expression in PDGFRα⁺ testicular cells indicates that these cells, including Leydig cells and PMCs, might also participate in electroactivity. The co-localization of ANO-1 with PDGFRα⁺ cells, mirroring the c-Kit expression pattern, points to potential shared signaling and regulatory functions. Their co-localization suggests that the roles of PDGFRα⁺ cells in the testis could be more complex than in the gastrointestinal tract. These findings require further studies to understand the intricate networks governing testicular cell function and explore novel aspects of Leydig and PMC cell physiology.

The TASK-1 channel, a K⁺ channel member, is notably expressed in mouse PDGFRα⁺ cells (Ha et al., 2017). PDGFRα⁺ cells are known to express the small conductance Ca²⁺-activated K⁺ channels (SK3), which are implicated in the purinergic neuromodulation of colonic muscle (Kurahashi et al., 2012). While this study did not directly investigate the functional expression of TASK-1 channels, it is plausible that PDGFRα⁺ cells across various tissues may express different types of channels. Analyzing the electrical properties of PDGFRα⁺ cells is, therefore, essential. The specific role of TASK-1 channels in Leydig cells and PMCs remains unclear, but they are hypothesized to contribute to sperm motility and hormone secretion by facilitating electrical changes, potentially in conjunction with ANO-1.

Further studies are needed to elucidate these roles. The co-expression of ANO-1 and TASK-1 with PDGFRα in Leydig cells and PMCs suggests a complex regulatory network influenced by these channels. These ion channels may play significant roles in cellular signaling and ionic homeostasis within the testis.

In conclusion, we demonstrate that PDGFRα is expressed in Leydig cells and PMCs within adult mouse testes. The observed expression pattern of PDGFRα offers valuable insights into its role in facilitating cell-cell interactions and signal transduction within the testicular environment. In particular, the co-localization of PDGFRα with c-Kit, ANO-1, and TASK-1 indicates that PDGFRα⁺ cells may be involved in regulating intracellular calcium signaling and ionic homeostasis.

None.

Conceptualization, E-A.K. and D.K.; data curation, M-S.W. and D.K.; formal analysis, M-S.W. and D.K.; funding acquisition, E-A.K. and D.K.; investigation, M-S.W. and D.K.; methodology, M-S.W., D-K.L. and D.K.; project administration, E-J.K.; supervision, C.E.L., E-A.K. and D.K.; validation, D.K.; visualization, M-S.W. and D.K.; writing - original draft, D.K.; writing - review & editing, E-A.K. and D.K.

This study was supported by the Basic Science Research Program through the National Research Foundation of Korea (2021R1I1A3044128 to Dawon Kang and 2022R1F1A1062897 to Eun-A Ko).

All animal experiments were conducted in compliance with the ethical standards set by the Gyeongsang National University Animal Care and Use Committee, under the approved protocols GNU-200702-M0041 for WT mice and GNU-230927-M0184 for PDGFRα^EGFP mice.

Not applicable.

Not applicable.

Not applicable.

No potential conflict of interest relevant to this article was reported.