The apoptosis process plays two very important roles in cell development (Edinger and Thompson, 2004; Fabian et al., 2005). The first plays a role in regulating the survival and development of cells, and the second plays a role in the generation of abnormal cells and the elimination of senescent cells (De Pol et al., 1997; Kim et al., 2012). In particular, the process of apoptosis signals occurs when cells undergo an inappropriate metabolic process at the time of metabolism, and most apoptosis is formed by the action of apoptosis according to the TNF (Tumor necrosis factor) signaling system. As such, the apoptosis process for cell development can be explained by dividing it into apoptosis and autophagy. In addition, the apoptosis process is involved in the breakdown of abnormal proteins and the remodeling of cells and tissues (Pattingre et al., 2005). In this regard, cells must undergo an adequate level of autophagy to maintain survival as well as intracellular homeostasis (Bergmann and Steller, 2010). Especially, autophagy is closely related to cell remodeling during tissue formation (Zeleznik et al., 1989; Kim et al., 2013). Recent reports have suggested that apoptosis, perhaps through autophagy, inhibits the development of granulosa cells and promotes the formation of follicular tissue occlusion (Bergmann and Steller, 2010; Kim et al., 2013). Moreover, apoptosis and autophagy are essential processes that use DNA fragmentation and break down organelles to remove unnecessary cellular components in response to various stresses to maintain cellular quality (Tilly, 2001; Edinger and Thompson, 2004). Recent studies have shown that SCNT (Somatic cell nuclear transfer)-derived embryos can be improved by processing cell culture with compounds that reduce apoptosis (e.g., TSA (Tumor-specific antigens), resveratrol) (Lee et al., 2019). However, studies on whether artificial regulation of apoptosis is possible in the process of cell development and tissue formation and the relationship between artificial regulation and cell development are very lacking. The reason is that the action of apoptosis is formed in a specific cell, and the composition of the detached tissue is reorganized according to the generation of other cells (Kim et al., 2013; 2018). However, such a result is a natural process achieved by the supply of sufficient nutrition. In particular, in the production of transgenic animals and the production of cloned animals, it is very important that cells develop while preserving the ability of donor cells (Lee et al., 2019). Therefore, in this study, the effect on cell growth and development was analyzed when 20 alpha-hydroxysteroid dehydrogenase (20α-HSD; induction of apoptosis), rapamycin (Rapa; induction of autophagy) and 3-methyladenine (3MA; inhibition of cell death) that can activate or control apoptosis were added during the culturing of skin cells and muscle cells, which are often used in animal cloning processes (Kim et al., 2017).

Animals and chemical treatment

Porcine skin and muscle tissue were collected from a local slaughterhouse (Pyeongtaek, Korea). 20α-HSD, 3-methyladenine (3MA) and Rapamycin (Rapa) (Sigma-Aldrich, St. Louis, MO, USA) were dissolved in DMEM (Dulbecco’s Modified Eagle’s Medium, Sigma-Aldrich) supplemented with 5% FBS (fetal bovine serum, Sigma-Aldrich) medium. Both skin and muscle cells were washed in DMEM medium supplemented with 20α-HSD, 3MA and Rapa and cultured for 72 h. Antibiotics were used at a fixed final concentration according to previous studies (Kim et al., 2017; Lee et al., 2019). Antibodies used are listed in Table 1.

Table 1. Target gene primer sequences.

Gene Primer name	Sequence	Product size
Porcine GAPDH Fw	5' CCCGTTCGACAGACAGCCGTG 3'	238
Porcine GAPDH Rv	5' CCGCCTTGACTGTGCCGTGG 3'
Porcine LC3A Fw	5' AGAAGCAGCTGCCAGTCCTGGACA 3'	687
Porcine LC3A Rv	5' CAGGCAGGCCTGAGCAATCTTTATT 3'
Porcine mTOR Fw	5' CTTTGTCCAGACCATGCAGCAGC 3'	120
Porcine mTOR Rv	5' TCGTTGATGCCCTGTAGGTTCAGCT 3'
Porcine Beclin-1 Fw	5' TGGCGGAAAATCTCGAGAAGGTCCA 3'	230
Porcine Beclin-1 Rv	5' TGTGCCAAATTGTCCACTGTGCCAA 3'
Porcine Casp-3 Fw	5' CATGGTCAGGCCTTGTGAAGCTGAC 3'	150
Porcine Casp-3 Rv	5' TCTTCTTCATGACCTCACCGTCGGG 3'
Porcine VEGF Fw	5' TCACCAAGGCCAGCACATAGGAGA 3'	164
Porcine VEGF Rv	5' TGCAGGAACATTTACACGTCTGCG 3'
Porcine PCNA Fw	5' GTGATTCCACCACCATGTC 3'	145
Porcine PCNA Rv	5' TGAGACGAGTCCATGCTCG 3'

Preparation of cells

Porcine skin and muscle cells were plated in DMEM (with 5% FBS) at a density of 3.5 ± 0.3 × 10⁷ in a tissue culture flask (T-25, Becton Dickinson and Co., Franklin Lakes, NJ, USA) for 16 h, to facilitate cell attachment. After basal culture, 1.2 × 10⁵/mL of each of pig skin and muscle cells were divided into DMEM (with 10%FBS) culture medium, and 20α-HSD (3 mM), 3MA (2.5 mM) and Rapa (100 nM) were added to each culture medium. And the cells were incubated for 24 to 120 h at 37℃ in a humidified atmosphere containing 5% CO2 and 95% air. To determine the number of live cells in the treated culture, the medium was replaced with fresh Trypsin-EDTA and the cells were cultured for 3 min at 37℃ in a humidified atmosphere containing 5% CO2 and 95% air. After, TC10 automated cell counter (Bio-Rad, CA, USA) was used to determine the density of live cells and total cells in the sample. The cell extracts were saved for real-time PCR, western blot, and immunofluorescence assays.

Quantitative RT-PCR analysis of autophagic and apoptotic genes

Total RNA, extracted from the cells scrapings using TRIzol reagent (Invitrogen, CA, USA), was treated with DNAse (Ambion, TX, USA), as per the manufacturer’s instruction, and quantified by UV spectrophotometry. First-strand cDNA was synthesized by reverse transcription of mRNA using Oligo (dT) primer and Super-Script II Reverse Transcriptase (Invitrogen, NY, USA). The information of primers is summarized in Table 1. For real time-PCR, the Line-gene K (Bioer Technology, Japan) was used to make a final volume of 25 µL, with SYBR Green (TOYOBO, Japan). The relative levels of analyzed mRNA gene were calculated using the 2-ΔΔCt method by standardization with porcine GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene expression levels.

Extraction of total proteins

For western blot and ELISA, total protein was extracted from all groups of both skin and muscle cells using Pro-prep solution (Intron, Korea) according to the manufacturer’s instruction. Total protein was quantified using Bradford protein assay (Bio-Rad), and the final protein samples were stored at -80℃.

Immune reactions analysis

Cells protein (30 µg) were separated by 13% SDS-PAGE (sodium-dodecyl-sulfate polyacrylamide gel electrophoresis) and transferred onto a PVDF membrane (polyvinylidene fluoride, Bio-Rad). After, primary antibodies used in this study were MAP1LC3A (LC3A, Abcam, Cambridge, UK), Beclin-1 (Abcam), Casp-3 (Abcam), and β-actin antibody (Santa cruz biotechnology, TX, USA). And next, antibody binding, the activated membranes were washed for 15 min with PBS-T buffer (1 × PBS with 2.5% Triton X-100) and then incubated for 2 h with HRP-conjugated rabbit or mouse secondary antibodies. The membranes were activated in the darkroom for 5 min in ECL (enhanced chemiluminescence) detection reagent and then exposed to a sheet of X-ray film in a film cassette for 1-15 min.

ELISA

To quantify specific protein from each cell, a PCNA (Proliferating cell nuclear antigen, Abcam), VEGF (Vascular endothelial growth factor, Santa cruz biotechnology) and mTOR (mammalian target of rapamycin, Abfrontier, SD, USA) primary antibody and proteins were applied to a 96-well ELISA plate and activated at 4℃ for 1 day. Then the plate was washed twice using washing buffer (PBS-T) and blocked using 1% skim milk at 4℃ for 24 h. After immune reactions were made using secondary antibodies (rabbit IgG-HRP antibody, Santa cruz biotechnology) for 2 h at room temperature, a substrate solution (R&D Systems, MN, USA) was added. To stop the reaction, 1 M NH2SO4 was used, and absorbency was measured at 450 nm.

Immunofluorescence assay

All treated cells were cultured on sterilized glass coverslips, fixed with 4% paraformaldehyde, and blocked with 0.1% BSA in PBS. After, slides were incubated with a monoclonal antibody that specifically recognizes the active form of the PCNA. After immune reactions, the slides were incubated with anti-rabbit IgG conjugated to Alexa-488 (Thermo fisher, MA, USA). Nuclei of cells were stained with 1 mg/mL Hoechst 33258, and slides were fixed using a fluorescent mounting medium (Dako, Carpinteria, CA). Next, images were acquired using an Olympus AX70 fluorescence microscope.

Statistical analysis

RT-PCR and ELISA data were tested for significance (Duncan and General Linear Model) using Statistical Analysis System software (SAS Institute, version 9.4, NC, USA). Statistical significance was established at p < 0.05.

Cell generation rate according to additive substances

After 72 h of cell culture, there was no significant difference in cell development between untreated cells from both cell types (untreated group in skin cells vs. untreated group in muscle cells); however, the untreated and 3MA groups exhibited lower development rate than Rapa group in both cell types (untreated and 3MA groups vs. Rapa group in both skin and muscle cells) (Table 2). When the cell development rate was compared between cells cultured for 48 h and 72 h, the significant differences were identified at untreated and Rapa groups in both skin cells (p < 0.05) and muscle cells (p < 0.01), but it did not in 20α-HSD and 3MA groups.

Table 2. Cell development rate from 0 h to 48-72 h.

Cell type	Treatments	48 h		72 h
		Cell number		Cell number
Skin cells (1.2 × 105)	-	6.58 ± 0.5 × 105		8.5 ± 0.5 × 105*
	20α-HSD	5.25 ± 0.5 × 105		7.21 ± 0.5 × 105
	3-methyladenine (3MA)	6.85 ± 0.5 × 105		7.08 ± 0.5 × 105
	Rapamycin (Rapa)	5.68 ± 0.5 × 105		9.2 ± 0.5 × 105**
Muscle cells (1.2 × 105)	-	6.22 ± 0.5 × 105		8.07 ± 0.5 × 105*
	20α-HSD	6.85 ± 0.5 × 105		7.25 ± 0.5 × 105
	3-methyladenine (3MA)	7.52 ± 0.5 × 105		7.09 ± 0.5 × 105
	Rapamycin (Rapa)	7.78 ± 0.5 × 105		9.5 ± 0.5 × 105**

*p < 0.05 or **p < 0.01 indicates a significant difference between each group of cultured cells for 48 h or 72 h, respectively..

Apoptosis or autophagy-related gene expression pattern

Fig. 1 shows the results of analyzing the expression patterns of genes related to apoptosis or cell survival according to each treatment group. Cell survival and apoptosis-related gene expressions were significantly different between skin cells and muscle cells. In particular, the expression of genes (mTOR and PCNA) related to cell survival showed a high expression pattern in both cells in the Rapa group, however, the 3MA group had a lowly expression pattern in both cells. As a result of analysis of the expression pattern of LC3A, an autophagy marker, the expression is significantly increased after Rapa treatment for 72 h in both cell types, but 3MA treatment could increase LC3A expression only in skin cells cultured for 48 h. The expression of Casp-3, an apoptosis factor, was increased in 20α-HSD-treated groups of the muscle cells, and in the case of skin cells, 3MA treatment group was high at 48 h. In the case of Beclin-1, which inhibits apoptosis, the expression was higher at 48 h in the 3MA treatment group and 72 h in the Rapa treatment group among the skin cells treatment groups. However, in the case of muscle cells, 20α-HSD treatment group was high at 72 h, and in the case of Rapa treatment group, it was high only at 48 h (Fig. 1).

Figure 1.Analysis of expression patterns of mRNA target genes related to cell death and survival. Cells were cultured for 48 h and 72 h for quantitative RT-PCR analysis. 3MA: 3-methyladenine, Rapa: Rapamycin. Bars in the graph represent mean ± S.D from 3 independent experiments. *^,**Different letters within the no-rapamycin vs rapamycin represent a significant difference (p < 0.05).

Activity analysis of apoptosis and cell survival factors

The analysis of the expression patterns of proteins related to cell survival and apoptosis in each treatment group is shown in Fig. 2 and 3. The activity of Casp-3 was increased very high in the 20α-HSD treatment group of both skin and muscle cells but was low in 3MA and Rapa. In the case of autophagy expression (LC3-Ⅰ and LC3-Ⅱ), the Rapa group showed the highest expression among the muscle cell groups (Fig. 2A). In the case of cell survival factors, mTOR, and VEGF, the Rapa-treated group of all cell groups was higher than that of the other treatment groups, and in general, the increase was very high at 48 h (Fig. 2B). PCNA analysis results, which are factors involved in metabolic action among cell survival signal factors, presented that muscle cells highly increased in Rapa treatment groups compared to other treatment groups (Fig. 3A). In PCNA expression in skin cells, its expression in 20α-HSD and Rapa treatment group were higher than that from 3MA treatment group. As a result of analyzing changes in PCNA during cell culture for 48 to 120 h, skin cells showed a similar pattern in all treatment groups, but the expression in 3MA treatment group decreased at 72 h and increased again at 96 h. In addition, the expression of PCNA protein in the Rapa treatment group increased smoothly from 48 to 120 h. In muscle cells, the 20α-HSD treatment group had similar protein expression at all incubation times, but 3MA treatment group presented gradual increasing pattern from 48 to 96 h and maintaining for the next 120 h. In addition, the Rapa treatment group increased rapidly from 48 h to 120 h, but decreased from 48 h to 72 h for the 20α-HSD treatment group and was maintained for 120 h (Fig. 3B).

Figure 2.Immuno-detected of programmed cell death and survival-related protein during treatment culture for cells development. Cells cultured for 72 h were analyzed. (A) Western blot, A-1: 20^α-HSD, A-2: 3MA, A-3: Rapa, (B) ELISA. *^,**Letters within the 20^α-HSD, 3MA, and Rapa supplement represent a significant difference (p < 0.05).

Figure 3.Expression site and surface analysis of PCNA protein of each treatment cell group. (A) Immunofluorescence (Cells cultured for 72 h.), (B) ELISA (Cells cultured for 48 h, 72 h, and 120 h.), O.D: optical density. (bar = 100 ^μm). The magnification of the photo is 400×.

The action of programmed cell death was thought to be related to cell reconstitution, and proper cell death seemed to affect cell development (Fengsrud et al., 2004). According to recent studies, inhibition of intracellular mTOR in follicle development and tissue composition may lead to cell starvation, leading to inflammation, which may lead to intracellular necrosis (Kim et al., 2018; Lee et al., 2019; Choi et al., 2020). One process that controls such an inflammatory response leads to TNF/P53 signaling, which is the general logic of accelerating cell death and reconstructing tissue by the action of intracellular matrix metalloproteinases (Xie and Klionsky, 2007; Kim et al., 2018). However, although a cell death process means natural cell death due to aging caused by the composition of cells and tissues (Levine and Klionsky, 2004), research on cell changes and cell development due to artificial cell death is inadequate. This study is to determine whether artificial apoptosis in the development of skin cells and somatic cells, which are often used as donor cells of cloned animals, can affect cell growth and development. Our results confirmed that the group caused autophagy increased cell development compared to the group added with 3MA, which inhibits cell death. In particular, this phenomenon is considered to have a very positive effect on muscle cells compared with skin cells. As in the results of Kim et al., 2013, the difference in development between cells is not large, but the growth of cells varies depending on the expression of cell death, which is formed during the metabolic process of muscle cells and skin cells. On the other hand, in the case of the 20α-HSD-added group, which is known to cause apoptosis, the mTOR was the high expression in the muscle cell group. Contrary to the research results that 20α-HSD is highly related to sex hormone signaling, it is thought to affect normal somatic cells (Kim et al., 2017; Park et al., 2017), and it also affected the expression of Casp-3, a cell-death factor. In the group added with 3MA, which is known to inhibit autophagy, the expressed pattern of genes related to cell death appeared to be slightly lower, relatively increased in SC. However, as in the results of other studies, it did not have a high effect on cell survival but preferably showed a low effected on the development of both skin and muscle cells (Xie and Klionsky, 2007; Lee et al., 2019). Peculiarly, when autophagy is was artificially generated, unlike apoptosis, was minimized inflammation around apoptotic cells in vitro culture, thereby maximally increasing cell development. These results can prove that the expression of PCNA, which has a goodly influence on cell survival, is increased, and the number of cells increased. In addition, it is thought that a result can be obtained because the cell survival signaling system related to survival is different for each cell, and when cell death is inhibited by the addition of 3MA (Galluzzi et al., 2007), cell generation is artificially regulated and paradoxically, it is thought to form apoptosis reaction.

In this study, when cell death was artificially generated or inhibited, it was confirmed that there was a difference in cell development according to the type of donor cell that had an important effect on the production of cloned animals. In the current production of cloned animals and customized stem cells, the normal development of the somatic cells is very important, and the maintenance of the normal development of the cells during in vitro culture is very important. Therefore, this study is considered that the generation of artificial autophagy during in vitro culture of somatic cells plays a very important role in cell normality and stable cell culture.

No potential conflict of interest relevant to this article was reported.