The majority of teeth are made of dentin, which is supported by enamel tissues. Dentin formation is facilitated by odontoblasts (Arana-Chavez and Massa, 2004). Dental problems such as caries, periodontal diseases, and physical injuries commonly affect dental pulp tissues. Odontoblasts play a crucial role in protecting against invasive pathogens in dental issues by triggering immunological inflammatory responses and reactive dentin formation in cases of carious invasion (Goldberg and Lasfargues, 1995). Moreover, within the dental pulp, progenitors have the ability to migrate and differentiate into odontoblast-like cells, thereby contributing to the formation of reparative dentin when odontoblasts are damaged (Farges et al., 2013). Consequently, research on odontoblast differentiation for dentin regeneration has garnered significant attention.

Mesenchymal stem cells (MSCs) possess several characteristics including self-renewal capacity, immunomodulatory properties, and multi-lineage differentiation potential including odonto/osteoblasts (Guo et al., 2013). MSCs have been identified in mammalian teeth (Li et al., 2021). The dental tissue-derived MSCs can be an excellent source for regeneration therapies targeting dental problems (Lee et al., 2016). Consequently, there is increasing interest in utilizing dental tissue-derived MSCs for differentiation into odonto/osteoblasts to aid pulp regeneration. It is crucial to select an appropriate differentiation method for MSCs to be employed as therapeutic agents in regenerative medicine.

For differentiation using stem cells, it is crucial to provide conditions that mimic the complex and intricate environment of the body (Moore and Lemischka, 2006; Keung et al., 2010; Lyssiotis et al., 2011). In dentin, there is cellular interaction between epithelial cells and mesenchymal cells. Epithelial-mesenchymal interactions are vital processes occurring during the development of various organs, such as hair follicles and mammary glands (Thesleff et al., 1995). Similarly, the initiation of tooth formation, differentiation of ameloblasts and odontoblasts, and tooth morphogenesis are regulated by a series of reciprocal interactions between the oral epithelium and mesenchymal cells derived from the cranial neural crests (Koch, 1967). Furthermore, epithelial cells are known to influence the differentiation potential of MSCs. It has been demonstrated that factors such as epithelial shortage can limit odontoblast differentiation and dentin regeneration using DPSCs (Smith and Warshawsky, 1977). Therefore, epithelial cells can play an important role in odontoblasts formation and dentin regeneration.

The present study involved the isolation of MSCs and epithelial cells from dental tissue, and their respective characteristics were confirmed. The MSCs were evaluated for the potential of differentiation into odontoblast, and compared between co-culture with/without epithelial cells.

Chemicals and media

All chemicals were purchased from Sigma (St. Louis, MO, USA) and media from Gibco (Invitrogen, Burlington, ON, Canada), unless otherwise specified.

Culture of dental pulp tissue derived mesenchymal stem cells (DP-MSCs)

All patients for dental tissue donation were provided informed contents, and the Ethics Committee of the Gyeongsang National University Hospital approved the study (GNUH-IRB-2018-11-002-001). The dental pulps were collected from immature wisdom teeth of eight patients (four men and four women) with an average age of 18.5 ± 2.3 years. MSCs from dental pulp were isolated by the previous protocol with minor modifications (Son et al., 2021; Oh et al., 2023). In brief, the dental pulp was separated from the dental crown using bone forceps, and the tissue was washed three times using Dulbecco’s phosphate-buffered saline (DPBS) containing 1% penicillin-streptomycin (10,000 IU and 10,000 μg/mL, respectively). The tissues were minced into small pieces (approximately 1 mm³) and digested by 1 mg/mL collagenase type I for 60 mins at 37℃. After digestion, the tissue samples were washed by culture media and passed through 100 μm and 40 μm nylon cell strainers (Falcon®, Franklin, NJ, USA) to collect single-cell suspensions. The culture media contained advanced Dulbecco’s modified Eagle’s medium (ADMEM) with 10% fetal bovine serum (FBS), 100 μg/mL streptomycin, and 100 IU/mL penicillin. The cell pellets were centrifuged at 300 g for 5 mins and cultured in 25T-flasks (Nunc^TM, Roskilde, Denmark). When the cells reached 70-80% confluence, the cells were harvested using 0.25% trypsin-ethylene-diamine-tetra-acetic acid (Trypsin-EDTA) solution and sub-cultured. All of the cells were cultured in an incubator at 37℃ in a humidified atmosphere containing 5% CO₂.

Isolation and culture of dental tissue-derived epithelial cells

The isolation of epithelial cells was conducted following the previous reports with minor modifications (Nam and Lee, 2009). Briefly, dental pulp tissues were minced in 1 mg/mL of collagenase type I and 2.4 mg/mL of dispase at 37℃ for 60 mins. After digestion, we washed tissue samples with keratinocyte-SFM (serum-free medium) three times. Single-cell suspensions were cultured in keratinocyte-SFM with supplements provided. The medium was changed every 48 hours, and cells were sub-culture at 70-80% confluency. All of the cells were cultured in an incubator at 37℃ in a humidified atmosphere containing 5% CO₂.

Flow cytometry analysis

To assess the MSCs surface marker using flow cytometry, cells were harvested by Trypsin-EDTA and fixed 4% paraformaldehyde solution for 30 mins at room temperature. The fixed cells were stained with fluorescein isothiocyanate (FITC)-conjugated anti-CD34 (1:200; BD Biosciences), CD45 (1:200; BD Biosciences), CD44 (1:200; BD Biosciences), CD73 (1:200; BD Biosciences), CD90 (1:200; BD Biosciences), and CD105 (1:200; BD Biosciences) for 60 mins at room temperature. The FITC mouse IgG1 (1:200; BD Biosciences) was used for isotype-matched negative control. Data were analyzed using FlowJo v10 software.

Differentiation into odonto/osteoblasts

The differentiation into odonto/osteoblasts was conducted as previously described with minor modifications (Arakaki et al., 2012; Son et al., 2021). We investigated the influences of epithelial cells on the differentiation process of DP-MSCs into odonto/osteoblasts using co-culture systems: Transwell Permeable Supports (Corning Inc., Corning, NY, USA). We divided the groups into groups with and without epithelial cells (1 × 10⁵ cells/well) placed at the upper compartment of the transwell, and DP-MSCs (1 × 10⁵ cells/well) were seeded in the lower compartment of the dish. When confluence reached 70-80%, differentiation was induced using odonto/osteogenic differentiation media, DMEM supplemented with 10% FBS, 1% penicillin/streptomycin, 10 mM β-glycerophosphate, 50 μg/mL ascorbate-2-phosphate, 10 nM dexamethasone for 14 days (Son et al., 2021). The media was changed every two days intervals.

Real-time quantitative polymerase chain reaction

To evaluate the differentiation ability of MSCs, the cells were analyzed for gene levels by RT-qPCR. Total RNA was isolated by RNeasy Mini Kit (Qiagen, Hilden, Germany) from the DP-MSCs and differentiated DP-MSCs according to the manufacturer’s instructions. The complementary DNA (cDNA) was synthesized with 500 ng purified RNA using HisenScript RT PreMix kit (iNtRON, Seongnam, Korea). RT-qPCR was reacted with Rotor-gene (Qiagen, Hilden, Germany) and the reaction mix contained RealMOD^TM Green AP 5 × qPCR mix (iNtRON, Seongnam, Korea), 200 nM of forward and reverse primers. RT-qPCR reaction was performed by the program under denaturation at 95℃ for 60 s followed by annealing and extension step at 50 cycles of 95℃ for 10 mins, 60℃ for 6 s, and 72℃ for 4 s. The Cycle threshold values (Ct values) were analyzed using Rotor-Gene Q Series Software 2.1.0 (Qiagen, Helden, Germany). The Ct values were normalized to mRNA relative level by Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ). The primers used in this study are listed in Table 1.

Table 1. Lists of primers used in RT-qPCR analysis.

Gene	Primer sequence	Product size (bp)	Accession no.
ALP (Alkaline phosphatase)	F: TCAGAAGCTCAACACCAACG	199	NM_000478.4
	R: GTCAGGGACCTGGGCATT
DMP-1 (Dentin matrix acidic phosphoprotein 1)	F: TGGAGTTGCTGTTTTCTGTAGAG	128	NM_004407.3
	R: ATTGCCGACAGGATGCAGA
DSPP (Dentin sialophosphoprotein)	F: GGCAGTGCATCAAAAGGAGC	253	NM_014208.3
	R: TGCTGTCACTGTCACTGCTG
Bmi-1 (Polycomb complex protein BMI-1)	F: ACAGCCCAGCAGGAGGTATTC	527	NM_001428312.1
	R: GCCCAATGCTTATGTCCACTG
p75 (p75 neurotrophin receptor nerve growth factor)	F: TTCAAGGGCTTACACGTGGAGGAA	721	NM_002507.4
	R: TGTGTGTAAGTTTCAGGAGGGCCA
△Np63 (deltaNp63)	F: CAGACTCAATTTAGTGAG	440	XM 036421
	R: AGCTCATGGTTGGGGCAC
ABCG2 (Homo sapiens ABC transporter ABCG2)	F: AGTTCCATGGCACTGGCCATA	379	AY017168
	R: TCAGGTAGGCAATTGTGAGG
YWHAZ (Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activationprotein, zeta)	F: CGAAGCTGAAGCAGGAGAAG	113	NM_003406.3
	R: TTTGTGGGACAGCATGGATG

Immunocytochemical stain

Immunocytochemical stain was performed to evaluate the expression of odonto/osteoblasts-specific marker. The cells were fixed with 4% paraformaldehyde for 15 mins at room temperature and permeabilized in 0.1% Triton-X for 10 mins. To block non-specific proteins, the cells were blocked with 3% BSA solution for 60 mins. The cells were reacted with primary antibody such as ALP (1:200; Santa Cruz, TX, USA), DMP1 (1:200; Santa Cruz, TX, USA), and DSPP (1:200; Santa Cruz, TX, USA) for overnight at 4℃. Then, cells were incubated with FITC-conjugated secondary antibodies at room temperature for 60 mins and followed by counterstaining with 1 μg/mL 4’,6–diamidino-2–phenylindole (DAPI) for 5 mins. The image of the fluorescence signal was obtained by fluorescence microscope (Leica, Wetzlar, Germany). The number of odonto/osteoblasts was determined using Photoshop CS6 software by counting positive signal in ten randomly captured high power fields.

Alkaline phosphatase activity

To analyze the Alkaline phosphatase activity of odonto/osteoblasts, the cells was measured by TRACP and ALP assay kit (Takara Bio Inc, Noji higashi, Japan) according to the manufacturer’s instructions. The DP-MSCs were differentiated into odonto/osteoblasts in 96-well plate for 14 days. The cells were removed from the differentiated media and reacted with 50 μL of extraction solution and substrate solution in each well at 37℃. After reaction, the cells were treated 50 μL of stop solution (0.5 N NaOH) for termination of reaction and analyzed to absorbance at 405 nm by VERSAmax microplate reader (Molecular Devices, San Jose, CA, USA). Then, ALP activity values were normalized as total cellular protein estimated by BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA).

Calcium colorimetric assay

To estimate calcium content, colorimetric assay kit (Biovision, Milpitas, San Francisco, USA) used to measure calcium contents according to the manufacturer’s instructions. The differentiated DP-MSCs were detached and suspended in a 500 μL calcium assay buffer and centrifuged at 500 g for 5 mins. After centrifugation, the cells were seeded in 96-well culture plate. The calcium assay buffer and chromogenic reagent were added to each well at 20℃ for 10 mins. Absorbance at 575 nm was obtained using VERSAmax microplate reader in each well. The calcium contents were normalized by total cellular protein value measured by BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA).

Statistical analysis

The statistical differences among all groups were estimated by one-way analysis of variance (ANOVA) with Tukey’s post hoc in this study. The SPSS version 23 (IBM) was used for analysis. All data were represented as mean ± standard deviation (SD) and p < 0.05 was considered significant.

Isolation and characterization of dental pulp tissue-derived MSCs and epithelial cells

MSCs were successfully isolated from dental pulp tissue (DP-MSCs). At passage 3, DP-MSCs showed homogenous spindle-like morphology with a capacity for plastic attachment (Fig. 1A). The expression of MSC-specific markers was assessed using flow cytometry, revealing positive expression of markers such as CD44, CD73, CD90, and CD105, while hematopoietic markers such as CD34 and CD45 were not detected (Fig. 1B). The epithelial cells derived from the dental cavity were isolated and cultured. After passage 2, the cells were maintained well-defined small polygonal morphology (Fig. 1A). Characterization of epithelial cells was performed through gel electrophoresis of epithelial cell-specific gene amplicons such as Bmi-1, p75, △Np63, and ABCG2 (Fig. 1C).

Figure 1.(A) MSCs derived from dental pulp and epithelial cells at passage 3 were observed under phase-contrast microscope. (scale bar = 100 μm). The spindle-like morphology was observed in dental pulp MSCs. In epithelial cells, well-defined small polygonal morphology was observed. (B) Analysis of the cell surface marker’s expression in DP-MSCs. The blue peak show isotype IgG expression as a control. Each CD marker expression is represented by red peaks. MSC-specific markers such as CD44, CD73, CD90, and CD105 were highly expressed while negative for the hematopoietic markers such as CD34 and CD45. (C) Expression of the epithelial cell-specific genes was analyzed. The epithelial cell-specific gene amplicons such as Bmi-1, p75, △Np63, and ABCG2 were observed in gel electrophoresis.

Odonto/osteogenic differentiation potential of DP-MSCs using epithelial cell co-culture system

To investigate the effect of co-culturing of DP-MSCs with epithelial cells on differentiation potential, the odonto/osteogenic differentiation capacity of the DP-MSCs was assessed according to the previously described protocol (Son et al., 2021). After 14 days, both differentiated cells with/without epithelial cells co-culture significantly expressed odonto/osteoblasts-specific markers such as ALP, DMP-1, and DSPP compared to non-differentiated cells (p < 0.05) (Fig. 2). The expression of genes such as ALP, DMP-1, and DSPP was significantly increased in differentiated cells with epithelial cells co-culture than without co-culture (p < 0.05) (Fig. 2). Mineral nodule formation was confirmed by Von Kossa and ALP staining. The staining intensity was higher in differentiated cells with epithelial cells co-culture than without co-culture (Fig. 3A and 3B). Additionally, calcium content and ALP activity were significantly increased in both differentiated cells with/without epithelial cells co-culture and were higher in differentiated cells with epithelial cells co-culture than without co-culture (p < 0.05) (Fig. 3A and 3B). To further evaluate the odonto/osteoblasts differentiation potential, the odonto/osteoblasts-specific proteins from both differentiated cells such as ALP, DMP-1, and DSPP were analyzed by immunocytochemical staining. All the proteins were expressed in both differentiated cells with/without epithelial cells co-culture (Fig. 4A). However, differentiated cells with epithelial cells co-culture showed a significantly higher number of odonto/osteoblasts-specific proteins-positive cells including ALP, DMP-1, and DSPP than those without co-culture (p < 0.05) (Fig. 4B).

Figure 2.DP-MSCs induced into odonto/osteoblast co-culture with/without epithelial cells. Expression of odonto/osteoblast-specific genes ALP, DMP-1, and DSPP were analyzed by RT-qPCR. The differentiated cells with/without epithelial cells significantly expressed odonto/osteoblasts-specific genes. The expression of genes in co-culture with epithelial cells was higher than without epithelial cells. Data are represented by the mean ± SD of four independent experiments. Lettered subscripts indicate statistical differences between groups (p < 0.05).

Figure 3.The evaluation of mineralization and calcium contents using Von Kossa and ALP staining. (A) Odonto/osteoblasts with epithelial cells had higher staining intensity than without epithelial cells (scale bar = 100 μm). (B) ALP activity and calcium content were significantly increased in odonto/osteoblasts with/without epithelial cells. ALP activity and calcium content in co-culture with epithelial cells were higher than without epithelial cells. Data are represented by the mean ± SD of four independent experiments. Lettered subscripts indicate statistical differences between groups (p < 0.05).

Figure 4.Quantified immunocytochemical analysis of odonto/osteoblast. (A) Immunocytochemical staining showed positive expression of odonto/osteoblast-specific markers. Nuclei were stained with DAPI (scale bar = 100 μm). (B) All marker proteins positive cells in odonto/osteoblast with epithelial cells were significantly increased than odonto/osteoblast without epithelial cells. Data are represented by the mean ± SD of four independent experiments. Lettered subscripts indicate statistical differences between groups (p < 0.05).

MSCs derived from dental tissue have differentiation potential and regeneration capacity. Odontoblasts play an important role in extending cytoplasmic process into dentinal tubules and forming typical hard tissue (Kawashima and Okiji, 2016). The present study demonstrated an efficient method for differentiation into odonto/osteoblasts derived from DP-MSCs. The levels of odonto/osteoblasts-specific genes and protein were up-regulated in differentiated cells. Similarly, the calcium content and ALP activity were significantly increased in differentiated cells. Importantly, the co-culture of DP-MSCs with epithelial cells significantly enhanced the odonto/osteogenic differentiation potential compared to cultures without epithelial cells. These findings suggest that co-culture with epithelial cells is a more effective method for promoting odonto/osteogenic differentiation.

DP-MSCs were identified and isolated from human dental pulp. The present study revealed that DP-MSCs exhibited a homogenous spindle-like morphology with plastic attachment ability, and specific CD markers expression. Previous studies demonstrated that dental tissue-derived MSCs possess properties such as fibroblast-like morphology, plastic attachment, and MSC-specific CD markers (Son et al., 2021; Oh et al., 2023). Epithelial cells isolated from the dental cavity displayed a characteristic small polygonal morphology, typical of epithelial cells (Mohd Yunus et al., 2021). Keratinocytes, specialized epithelial cells, are regulated by the low-affinity neurotrophin receptor p75 (Botchkarev et al., 2000). Basal cells in many human epithelial tissues produce the p63 protein at high levels, with expression primarily of the truncated dominant-negative isoform △Np63 (Yang et al., 1999; Barbareschi et al., 2001). Expression of epithelial cell-specific genes was confirmed in cells isolated from the dental cavity using qRT-PCR, consistent with previous studies (Nam and Lee, 2009).

Due to the specific cellular composition of dental pulp, it serves as an excellent source of stem cells for odontoblast development (Guo et al., 2013; Woo et al., 2015). DP-MSCs were successfully differentiated into odonto/osteoblasts, as confirmed by the expression of odontoblast-specific genes and proteins, including ALP, DMP-1, and DSPP. ALP is crucial for assessing osteoblastic proliferation and early/late osteoblastic differentiation. DSPP and DMP-1, which play key roles during early odontoblastic differentiation and late dentin mineralization, represent the main odontoblast phenotypic genes (Ching et al., 2017). Moreover, the odonto/osteoblasts demonstrated the formation of mineral nodules, as indicated by ALP and Von Kossa staining. Several studies have reported progressive appearance of calcium deposits and mineralization nodules during odonto/osteogenic differentiation (Baldión et al., 2018).

Von Kossa and ALP staining revealed the deposition of calcium, indicating mineralization resulting from odonto/osteogenic differentiation, wherein odontoblasts play a crucial role in transporting calcium during the mineralization process. These findings align with previous studies on odonto/osteogenic differentiation from MSCs (Li et al., 2013; Lim et al., 2021). In summary, DP-MSCs possess the capacity for differentiation into odonto/osteoblasts.

To facilitate cell differentiation and proliferation, it is crucial to establish environments that closely mimic those found in the body (Moore and Lemischka, 2006; Keung et al., 2010; Lyssiotis et al., 2011). Many researchers have employed co-cultures of epithelial and mesenchymal-type cells to replicate tissue composition found in vivo (Seltana et al., 2010; Goers et al., 2014). It has been demonstrated that DP-MSCs co-cultured with epithelial cells exhibit more efficient odonto/osteogenic differentiation potential compared to cultures without epithelial cell co-culture. Dental epithelial cells have been found to secrete BMP2 and BMP4 (Arakaki et al., 2012). In undifferentiated mesenchymal cells, the BMP signaling pathway in cooperation with Runx2, Dlx5, and Msx1 induces the expression of DSPP (Chen et al., 1996). Previous studies have shown that blocking BMP signaling in dental pulp stem cells interrupts odontoblastic differentiation (Arakaki et al., 2012). Additionally, interactions with epithelial cells, such as those of the inner dental epithelium, epithelial rest, and epithelial diaphragm, contribute to the formation of both crown and root odontoblasts (Ten Cate, 1996). These findings support the notion that co-culture with epithelial cells is an effective strategy for the in vitro production of dentinal/osteoblasts.

In this study, we evaluated the odonto/osteoblast differentiation potential of dental pulp-derived MSCs. Our findings indicate that these cells possess the capacity for odonto/osteoblast differentiation. Moreover, we demonstrated that co-culturing with epithelial cells during differentiation significantly enhances the in vitro capacity for odonto/osteoblast differentiation. While further research is warranted to explore applications for mimicking the body’s environment in stem cell differentiation, our study suggests that co-culturing with epithelial cells for odonto/osteogenic differentiation is a promising method.

This study was supported by Chonnam National University (grant number: 2024-0421).

Conceptualization, S-Y.L., and Y-B.S.; methodology, S-Y.L., Y.W.J., and S-J.O.; investigation, S-Y.L., S-J.O., R.M., Y-H.C, and Y.W.J; validation, S-J.O., R.M., and Y-H.C.; formal analysis, S-Y.L.; resources, Y-H.C.; writing—original draft preparation, S-Y.L.; writing—review and editing, S-Y.L., S-L.L., and Y-B.S.; funding acquisition, Y-B.S. All authors have read and agreed to the published version of the manuscript.

This study was financially supported by Chonnam National University (grant number: 2024-0421).

All patients for dental tissue donation were provided informed contents, and the Ethics Committee of the Gyeongsang National University Hospital approved the study (GNUH-IRB-2018-11-002-001).

Not applicable.

Not applicable.

Not applicable.

No potential conflict of interest relevant to this article was reported.