The clinical application of mesenchymal stem cells (MSCs) derived from canines has been steadily increasing, driven by their therapeutic potential in regenerative medicine and veterinary treatments (Dias et al., 2019; Voga et al., 2020; Prządka et al., 2021). However, MSCs are rare in vivo, making it essential to isolate and expand these cells in vitro through adherence to plastic surfaces and continuous passaging (Bruder et al., 1997). However, continuous in vitro expansion of MSCs can influence their proliferation rate, cell size, differentiation capacity, and lead to chromosomal and molecular instabilities, potentially resulting in varied outcomes in MSC-based therapies (Wagner et al., 2010; Krešić et al., 2017). Therefore, for effective clinical use, large quantities of MSCs are required, necessitating reliable and scalable culture methods.

Traditionally, fetal bovine serum (FBS) has been considered indispensable for the in vitro culture of MSCs, providing the necessary growth factors and nutrients to support cell proliferation (Pilgrim et al., 2022). However, the use of FBS presents significant challenges, particularly in the context of clinical applications for canine MSCs. FBS has been recognized as a potential vector for contamination by adventitious agents, raising concerns about its safety (Anselme et al., 2002). Additionally, while in vitro expansion of MSCs using FBS has generally been safe, with no toxic side effects observed during intravenous infusion (Cho et al., 2024), there have been reports of adverse immune responses in some cases (Horwitz et al., 2002; Sundin et al., 2006). Other risks associated with FBS include the potential transmission of viral or bacterial infections and prions, making it less than ideal for clinical-grade cell culture (Will et al., 1996; Selvaggi et al., 1997; Tuschong et al., 2002).

To address these concerns, alternative culture protocols have been explored, particularly in the context of human MSC research. These alternatives include the use of platelet lysates, serum-free media, and autologous serum as substitutes for FBS (Pilgrim et al., 2022). While there have been a few studies exploring the use of platelet lysates and serum-free media in canine MSC culture (Clark et al., 2016; Devireddy et al., 2019; Hagen et al., 2022; Rashid et al., 2023), the results have been inconsistent, and there has been no research applying autologous serum in this context. Given the need for safer and more reliable culture methods for the large-scale production of canine MSCs for clinical applications, research into the use of autologous serum as an alternative to FBS is warranted.

In this study, we applied allogeneic serum to the culture of canine MSCs, investigating its effects on cell proliferation efficiency, cellular senescence and stress during long-term culture, and the expression of key pluripotency-related genes. Our research aims to provide insights into the viability of using allogeneic serum as a safer and more effective alternative for the large-scale expansion of canine MSCs intended for clinical use.

Isolation and culture of MSCs derived from human and canine fat tissues

For the isolation of canine MSCs, abdominal fat tissues were collected from four 1-year-old female beagle dogs by tissue biopsy. Collected fat tissues were chopped into small pieces, and then digested using 0.2 mg/mL collagenase type IV. The suspension of cells was plated in 35 mm dishes with the culture medium. All procedures were approved by the Institutional Animal Care and Use Committee of Gyeongsang National University (Permit No: GNU-210216-D0017).

Human adipose-derived MSCs were obtained from cells used in our previous study (Jeon et al., 2011). Briefly, Adipose tissues from female patients (ages 16-18) were collected undergoing orthognathic surgery at Gyeongsang National University Hospital with patient consent (GNUH IRB-2009-34). The minced adipose tissue digested using 1 mg/mL collagenase type I. After digestion, the suspension was filtered through 100-μm and 50-μm strainers to obtain single-cell suspensions and then cells were plated in 35 mm dishes with the culture medium.

The culture medium for both canine and human MSCs was composed of advanced-Dulbecco’s Modified Eagle’s Medium (ADMEM) containing 10% heat-inactivated fetal bovine serum (FBS), 200 nM L-glutamine, 100 IU/mL penicillin, and 100 μg/mL streptomycin. The cells were cultured at 37℃ in a humidified atmosphere of 5% CO₂ in air, and the culture medium was changed twice a week. At 90% confluence, attached cells were harvested for subculture using 0.25% trypsin EDTA, and split at a 1:4 ratio.

Preparation of allogenic serum

Allogeneic serum preparation followed previously established protocols (Gregory et al., 2006). Whole blood was drawn from canine donors and collected in 50 mL conical tubes without anticoagulants, allowing it to clot at room temperature for 4 hr. The serum was then separated from the clot and centrifuged at 500 × g for 20 min. The resulting supernatant underwent an additional centrifugation at 2,000 × g for 20 min. The cleared serum was incubated at 56℃ for 20 min to inactivate complement proteins and subsequently stored at -80℃ until use. Before applying to canine MSC culture, the medium containing allogeneic serum was filtered through a 0.22-μm membrane.

The measurement of population doubling time (PDT)

At every passage, 1 × 10⁴ MSCs were seeded in the 6 well-plate, and cultured for 96 hr at 37℃, 5% CO₂. The population of doubling time was calculated by the following formulation: T × log2 / (logN_H - logN_I). T is culture time, N_H is the number of cells harvested after 96 hr of culture, and N_I is the initial number of cells (1 × 10⁴).

Senescence associated β-galactosidase assay

Senescent cells were identified using the Senescence β-Galactosidase Staining Kit (Cell Signaling Technology, Danvers, MA, USA) following the manufacturer’s protocol. In brief, cells at full confluency were fixed with a fixative solution for 15 min at room temperature. Following two rinses with DPBS, the cells were incubated overnight in a dry incubator at 37℃ with β-Galactosidase staining solution. Senescent cells, indicated by blue staining, were observed using a phase-contrast microscope.

For the colorimetric analysis of β-galactosidase activity in senescent cells, the Mammalian β-Galactosidase Assay Kit (Thermo Fisher Scientific, MA, USA) was used according to the manufacturer’s guidelines. Fully confluent cells were harvested and lysed with M-PER reagent at room temperature for 10 min. After centrifuging at 27,000 × g for 10 min, cell debris was removed, and the supernatant containing cell extracts was collected. The extracts were then loaded into a 96-well plate, followed by the addition of X-gal reagents. After a 30 min incubation, absorbance was measured at 405 nm using a microplate reader.

The analysis of cell apoptosis

The apoptosis levels in canine MSCs were assessed using the Annexin V/Dead Cell Apoptosis Kit (Invitrogen, Waltham, MA, USA). Collected cells were incubated with 5 μL of Alexa Fluor 488-conjugated anti-annexin V antibody and 1 μL of 100 μg/mL propidium iodide (PI) for 15 min at room temperature. The stained cells were subsequently analyzed via flow cytometry using a BD FACSVerse instrument (BD Bioscience, NJ, USA), and the data were processed with FlowJo v10 software.

Quantitative real time-PCR (qRT-PCR) analysis

The expression level of cellular senescence, stress, and pluripotency-related genes was analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA was isolated utilizing the easy-spin^TM Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Republic of Korea), following the protocol provided by the manufacturer. Complementary DNA (cDNA) was synthesized from 500 ng of RNA using the HiSenScript^TM RH (-) RT PreMix Kit (iNtRON Biotechnology). For qRT-PCR, a mixture containing 50 ng of cDNA, RealMOD^TM Green AP 5× qPCR mix (iNtRON Biotechnology), and specific primers were prepared. The sequences of the primers used for targeting specific genes are provided in Table 1. The qRT-PCR was conducted using the Rotor-Gene Q cycler (Qiagen, Hilden, Germany). The cycling conditions included an initial denaturation step at 95℃ for 12 min, followed by 40 cycles of denaturation at 95℃ for 15 sec, annealing at 60℃ for 25 sec, and extension at 72℃ for 25 sec. The cycle threshold values (Ct values) were determined by Rotor-Gene Q Series Software 2.1.0 (Qiagen), and Ct values were normalized by hypoxanthine phosphoribosyltransferase 1 (Hprt1).

Table 1. The sequence of primers used in qRT-PCR.

Target gene	Primer sequence	Product size (bp)	Annealing temp (℃)	Accession number
Bax	F:TTTGCTTCAGGGTTTCATCC	146	60	NM_001003011.1
	R:TGTTACTGTCCAGTTCATCTCC
Bak	F:TCTACTTCTGAGGAGCAGGTAGC	153	60	NM_001020808.1
	R:CATGGTGCTGCTAGGTTCTAGG
Bcl2	F:GGGTCATGTGTGTGGAGAGC	180	60	NM_001002949.1
	R:GCCAGGAGAAGTCAAACAGAGG
Birc5	F:ACATTCATCTGGTTGTGCTTTCC	157	60	NM_001003348.1
	R:CACTTTCTTTGCGGTCTCTTCG
Hsp70	F:GGTGCAGGTGAGCTACAAGG	158	60	NM_001003067.2
	R:GCTGCGAGTCGTTGAAGTAGG
Hsp90	F:CGTGGAAAGAATGAAGGAGAAGC	146	60	NM_001003327.2
	R:AGTATTCGTCCACAGGTTCGG
Oct4	F:AACGATCAAGCAGTGACTATTCG	147	60	XM538830.1
	R:AGTAGAGCGTAGTGAAGTGAGG
Sox2	F:AGTCTCCAAGCGACGAAAAA	189	60	DR105272
	R:CCACGTTTGCAACTGTCCTA
Nanog	F:GACCGTCTCTCCTCTTCCTTCC	157	60	XM_014108418.1
	R:CGTCCTCATCTTCTGTTTCTTGC
Hprt1	F:TCATCATTACGCTGAGGATTTGG	150	60	NM_001003357.2
	R:AAGAATTTATAGCCTCCCTTGAGC

Bax, BCL2 associated X; Bak, BCL2 antagonist/killer 1; BCL2, B-cell leukemia/lymphoma 2; Birc5, baculoviral IAP repeat-containing 5; Hsp70, heat shock protein 70; Hsp90, heat shock protein 90; Oct4, POU class 5 homeobox 1; Sox2, SRY-box transcription factor 2; Nanog, Nanog homeobox; Hprt1, hypoxanthine phosphoribosyltransferase 1..

Statistical analysis

Data were presented as mean ± standard error of the mean (SEM). The statistical significance of differences was analyzed by an unpaired two-tailed Student’s t-test or one-way analysis of variance (ANOVA) with Tukey’s test for multiple comparisons using GraphPad Prism 8.0.1. A statistical difference of less than 0.05 indicated statistically significant.

Differential in vitro growth capacity in human and canine mesenchymal stem cells

In this study, we compared the in vitro culture trends of mesenchymal stem cells (MSCs) derived from canine and human sources by analyzing their population doubling times (PDT) (Fig. 1). Human MSCs were cultured from primary culture up to passage 15. The population doubling time was initially around 33 hours during the early passages. As the passages progressed, a gradual increase in PDT was observed, reaching approximately 45 hours by passages 9 and 10. By passage 15, the PDT further extended to 61 hours, indicating a steady, gradual increase in doubling time with each passage. In contrast, canine MSCs exhibited a significantly different trend. Initially, these cells demonstrated a very rapid proliferation rate, with a mean PDT of 16.68 hours. However, this rapid growth phase was followed by a sharp increase in doubling time. On average, the PDT increased to 52.91 hours during subsequent passages. Eventually, the PDT reached approximately 130 hours, at which point the canine MSCs ceased to proliferate.

Figure 1.Population doubling time (PDT) comparison between human and canine mesenchymal stem cells (MSCs) in vitro. The population doubling time of human and canine MSCs was measured. The Y-axis represents population doubling time (hr), and the X-axis indicates the passage number. The filled box shows the PDT of human MSCs, analyzed from passage 0 to passage 15 (n = 3). The open box indicates the PDT of canine MSCs at each passage number, passage 0-12 (n = 4). Symbols are presented as mean ± SEM. The significance of differences was determined using one-way ANOVA with Tukey’s post-hoc test. ^a,b,cp < 0.05.

Effect of allogeneic serum on in vitro expansion of canine MSCs

In this study, we investigated the effects of canine serum (allogeneic serum) on the morphological changes and in vitro growth capacity of canine MSC (Fig. 2). The experimental design categorized canine MSCs into three groups based on the PDT analyzed in the previous experiment in Fig. 1: early passage (passage 3), mid-passage (passage 7), and late passage (passage 10). Initially, canine MSCs were cultured in a medium containing 10% fetal bovine serum (FBS). To adapt canine MSCs to the new serum conditions, the percentage of canine serum was gradually increased from 0% to 10% during the adaptation phase from passage 0 to passage 3 (Fig. 2A).

Figure 2.Effect of allogeneic serum on the morphological changes and PDT of canine MSCs. (A) Experimental design shows that canine MSCs were categorized into three groups based on passage number: early passage (passage 3), mid-passage (passage 7), and late passage (passage 10). Canine MSCs were initially cultured in a medium containing 10% FBS. During the adaptation phase from passage 0 to passage 3, the percentage of canine serum was gradually increased from 0% to 10%. (B) Canine MSCs cultured in FBS medium and allogeneic serum medium were observed under the phase-contrast microscope (×40), size bar = 200 μm. (C) The PDT of canine MSCs was measured for both FBS and allogeneic serum groups. Symbols are presented as mean ± SEM. The significance of differences was determined using the student t-test. ***p < 0.001 versus the allogeneic serum group.

Morphological changes were analyzed under both FBS and allogeneic serum conditions. Canine MSCs cultured in the FBS medium exhibited an increase in cell size and elongation over time, along with significant amounts of cellular debris observed in the culture medium. In contrast, canine MSCs cultured in an allogeneic serum medium maintained an initial size and showed no significant morphological changes up to passage 10, closely resembling early passage cells (Fig. 2B).

Next, the PDT of canine MSCs was also measured to assess the proliferative capacity under different serum conditions (Fig. 2C). In the FBS group, the PDT initially around 16 hours in the early passages increased significantly in the later passages. However, in the allogeneic serum group, the PDT remained stable from early to late passages, showing only a slight increase from 16 hours to 18 hours. This stability in PDT suggests that the allogeneic serum helps maintain a more consistent proliferative capacity compared to FBS.

Allogeneic serum reduces cellular senescence of canine MSCs in vitro culture conditions

Next, we investigated the impact of allogeneic serum on cell senescence in canine MSCs. We first assessed senescence-associated β-galactosidase (SA-β-Gal) activity to evaluate cellular senescence in canine MSCs. When cultured in FBS, beta-galactosidase activity increased, reaching higher levels at the late passage (Fig. 3A). Canine MSCs cultured in FBS containing medium demonstrated an increased number of SA-β-Gal positive stained cells (Fig. 3A, left panel) and significantly elevated β-galactosidase activity compared to cAD-MSCs and cSK-MSCs (Fig. 3A, right panel). This increase indicates enhanced cellular senescence under FBS conditions. Conversely, canine MSCs cultured in allogeneic serum exhibited reduced beta-galactosidase activity, suggesting decreased cellular senescence.

Figure 3.Analysis of cell senescence and apoptosis in canine MSCs cultured with FBS and allogeneic serum. (A) Representative images of senescent canine MSCs stained with β-galactosidase staining from early to late passage (right panel), size bar = 200 μm. The levels of β-galactosidase activity were measured by the colorimetric β-galactosidase assay kit (n = 4, left panel). (B) Flow cytometry analysis using Annexin V and PI staining (n = 4). Representative flow cytometric panel (left) and compiling data is depicted (right). (C, D) Gene expression analysis of apoptosis and cellular stress-related genes: Bax, Bak, Bcl2, Birc5, Hsp70, and Hsp90 (n = 4). Bar graphs are presented as mean ± SEM, with significant differences determined by one-way ANOVA followed by Tukey’s post-hoc test. **p < 0.01; ***p < 0.001 versus indicated comparator.

In addition, we analyzed cell apoptosis using flow cytometry with Annexin V and PI staining (Fig. 3B). Canine MSCs cultured in FBS demonstrated a significant increase in apoptosis levels as they progressed to later passages. In contrast, the apoptosis levels were markedly reduced in canine MSCs cultured in allogeneic serum.

To further investigate the molecular basis of these observations, we analyzed the expression of key apoptosis-related genes in canine MSCs cultured in FBS and allogeneic serum at early, mid, and late passages (Fig. 3C). In canine MSCs cultured in FBS, the expression of the pro-apoptotic genes Bax and Bak remained consistent across early, mid, and late passages, indicating no significant change in their expression. The anti-apoptotic gene Bcl2, however, showed an increase in expression from early to late passages, suggesting an upregulation of survival mechanisms over time. The expression of Birc5 decreased significantly at mid-passages and remained low at late passages, indicating a loss of this survival factor over time. The stress response genes Hsp70 and Hsp90 showed no significant changes in expression across all passages (Fig. 3D).

In canine MSCs cultured in allogeneic serum, Bax and Bak expression were significantly reduced at late passages compared to FBS conditions, indicating reduced apoptosis activity (Fig. 3C). Bcl2 maintained lower expression levels overall compared to FBS conditions (Fig. 3C). Birc5 expression remained consistent across early, mid, and late passages, unlike the decline observed under FBS conditions. The expression of Hsp70 showed a slight decrease at mid-passages and remained at lower levels at late passages compared to FBS conditions, suggesting a reduced stress response (Fig. 3D). Hsp90 expression levels remained unchanged across all passages, similar to FBS conditions (Fig. 3D).

Collectively, these results demonstrate that culturing canine MSCs in allogeneic serum significantly reduces apoptosis and cellular senescence compared to FBS, likely contributing to improved cell viability and stability over extended passages.

Expression of pluripotency-related transcription factors in canine MSCs cultured with FBS versus allogeneic serum

Next, we further analyzed the expression levels of pluripotency-related transcription factors Oct4, Sox2, and Nanog in canine MSCs cultured in allogeneic serum at early, mid, and late passages (Fig. 4). When cultured in FBS, the expression of Oct4, Sox2, and Nanog progressively decreased as canine MSCs reached later passage. Specifically, Oct4 and Nanog exhibited a marked reduction in expression starting from mid-passage. Sox2 maintained its expression levels from early to mid-passage but showed a significant decrease in late passage, similar to the trends observed for Oct4 and Nanog. In contrast, canine MSCs cultured in allogeneic serum showed a significant improvement in maintaining the expression of these transcription factors. For Oct4 and Sox2, a notable increase in expression was observed at mid-passage compared to MSCs cultured in FBS. Furthermore, Sox2 expression continued to increase in late passages in the allogeneic serum group. While Nanog expression did not increase, it remained stable, maintaining its initial levels throughout the passages, unlike the significant decline observed in the FBS group.

Figure 4.Comparison of pluripotency-related transcription factor expression in canine MSCs cultured in FBS and allogeneic serum medium during in vitro expansion. The expression levels of Oct4, Sox2, and Nanog were analyzed at early, mid, and late passage by RT-qPCR (n = 4). For normalizing the relative mRNA expression, Hprt1 was used as a reference gene. Bar graphs are presented as mean ± SEM; The significance of differences was determined using one-way ANOVA with Tukey’s post-hoc test. *p < 0.05; **p < 0.01; ***p < 0.001 versus indicated comparator and ^##p < 0.01; ^###p < 0.001 versus early passage in FBS group.

This study highlights the in vitro growth capacities and senescence characteristics of canine MSCs, focusing on the impact of canine allogeneic serum on canine MSCs. We observed distinct trends in PDT between canine and human MSCs, where canine MSCs initially proliferated rapidly but eventually displayed a sharp increase in PDT, leading to a cessation of proliferation. Furthermore, our analysis of the effects of canine allogeneic serum on canine MSCs revealed significant improvements in proliferation stability, reduced cellular senescence, and enhanced maintenance of pluripotency-related transcription factors compared to traditional FBS conditions.

The use of allogeneic serum in the culture medium demonstrated a marked improvement in the proliferative capacity of canine MSCs in this study. Our findings showed that while FBS-cultured canine MSCs exhibited a significant increase in PDT over time (Fig. 1), canine MSCs cultured in allogeneic serum maintained a more consistent proliferation (Fig. 2C). These results suggest that the components present in canine serum may provide a more supportive environment for sustained canine MSC growth, which aligns with the previous studies where species-specific serum improved cell proliferation and viability on human MSCs and rat MSCs (Gregory et al., 2006; Le Blanc et al., 2007). However, other studies have found no significant enhancement on the efficiency of isolation and in vitro growth of human MSCs (Anselme et al., 2002; Kim et al., 2005). These controversial results may stem from variations in the serum donor sources, preparation methods, quality control, and the concentration of serum used during culture. In our studies, we ensured that the canine allogeneic serum was within normal ranges of hematological parameters, as confirmed by serum chemistry, and we employed heat-inactivation to minimize immunogenic issues. Moreover, our results were validated across MSCs obtained from four different donors, highlighting the robustness of our findings.

The large amount and consistent use of autologous or allogeneic serum for MSC culture presents significant challenges for clinical use (Dimarakis and Levicar, 2006), particularly in terms of supply and quality control. So, serum-free supplements and autologous or allogeneic platelet lysate have been explored as alternatives to FBS, offering potential advantages for clinical applications (Pilgrim et al., 2022). However, in human MSCs, serum-free media alone have not been sufficient to enhance proliferation, often requiring the addition of expensive cytokines and growth factors to achieve desired growth rates (Gronthos and Simmons, 1995; Kuznetsov et al., 1997). Similar to these findings, the serum-free conditions of canine MSCs also required additional growth factors to improve cell growth. (Clark et al., 2016; Devireddy et al., 2019). In addition, platelet lysate has shown promise in supporting canine MSCs culture (Hagen et al., 2022; Rashid et al., 2023). However, as same with challenge of allogeneic serum, it has limitations, particularly regarding the challenges of consistent supply and quality control. Further research is needed to fully understand the potential and limitations of these alternatives in the context of canine MSCs culture.

In addition to enhanced proliferation, the use of allogeneic serum also significantly reduced cellular senescence and apoptosis in canine MSCs. We observed lower levels of senescence-associated β-galactosidase activity and reduced apoptosis markers in MSCs cultured with canine allogeneic serum (Fig. 3A and 3B). To further investigate the molecular mechanism of robust apoptosis in long-term cultured canine MSCs, we explored the expression of various genes regarding to cellular stress, damages, and apoptosis (Fig. 3C and 3D). The intrinsic and extrinsic apoptosis pathways have distinct initiation mechanisms but can converge on common executioner mechanisms (Elmore, 2007). The intrinsic pathway, also known as the mitochondrial pathway, is regulated by mitochondrial outer membrane permeabilization (MOMP) and involves proteins like Bax, Bak, and Bcl2 (Wang and Youle, 2009). In the intrinsic pathway, cellular stress or damage leads to the activation of Bax and Bak, which form pores in the mitochondrial membrane, releasing cytochrome c and activating caspases, particularly caspase-9 (Cory and Adams, 2002; Wang and Youle, 2009) . Bcl2 functions as an anti-apoptotic protein by inhibiting Bax and Bak, thus preventing MOMP (Cory and Adams, 2002). In the context of MSCs cultured in FBS, the lack of change in Bax and Bak expression suggests that the intrinsic pathway is not significantly activated despite increased apoptosis, possibly due to compensatory upregulation of Bcl2 (Fig. 3C). In contrast, MSCs cultured in canine serum show reduced expression of Bax and Bak, correlating with decreased apoptosis, indicating less activation of the intrinsic pathway. The extrinsic pathway, on the other hand, is initiated by extracellular death ligands binding to death receptors on the cell surface, such as Fas and TNF receptors, leading to the formation of the death-inducing signaling complex (DISC) and subsequent activation of caspase-8 (Kischkel et al., 1995; Elmore, 2007). The role of the extrinsic pathway in MSCs under different serum conditions requires further investigation.

The expression pattern of Birc5, commonly known as Survivin (Altieri, 2003), showed a significant decrease at mid-passage and remained low in late passages of FBS condition (Fig. 3C), which correlates with an increase in apoptosis observed in beta-galactosidase and annexin V/PI assays (Fig. 3A and 3B). This suggests that as Survivin expression declines, the ability to inhibit caspase activation diminishes, leading to increased apoptosis. Despite the presence of other anti-apoptotic signals like elevated Bcl2, the reduction in Survivin could be a critical factor in tipping the balance toward cell death as MSCs progress through passages (Singh et al., 2018). Interestingly, the expression of Survivin remained unchanged across passages in canine MSCs cultured in allogeneic serum (Fig. 3C). This stable expression of Survivin might contribute to the reduced apoptosis observed under these conditions, as it continues to inhibit caspase activation effectively. The prevention of a decrease in Survivin could be one of the key reasons why apoptosis is less pronounced in these MSCs compared to those cultured in FBS.

Our study also demonstrated that canine serum helps maintain the expression of key pluripotency-related transcription factors, such as Oct4, Sox2, and Nanog, throughout extended passages. Unlike FBS, which led to a significant decline in these factors, canine serum allowed for sustained or even increased expression (Fig. 4). This finding suggests that the specific factors within serum may support the maintenance of stemness in MSCs, aligning with previous findings that serum/plasma influence the differentiation potential of MSCs (Stute et al., 2004; Sun et al., 2008). These results underscore the importance of optimizing culture conditions to retain the therapeutic potential of MSCs over prolonged in vitro expansion.

The superior outcomes observed with allogeneic serum likely result from unique components within the serum that are not present in FBS, which could be crucial in supporting canine MSC proliferation and metabolism. While the exact nature of these components requires further investigation, our findings suggest that these factors may significantly influence cellular processes, offering a compelling case for the use of species-specific serum in MSC culture.

The promising results from our study suggest that canine MSCs cultured in allogeneic serum could be better suited for clinical applications, given their enhanced proliferative capacity, reduced senescence, and improved maintenance of pluripotency. As canine MSCs continue to be explored for regenerative medicine, our findings provide valuable insights into optimizing culture conditions to harness their full therapeutic potential. This study thus offers a significant contribution to the advancement of MSC-based therapies, particularly for veterinary applications.

None.

Conceptualization, Y.C., S-L.L.; methodology, Y.C., S-Y.L., H.L., C-H.J., S-J.O., T-S.K., and C-Y.H.; investigation, Y.C., Y-B.S., and W-J.L.; data curation, Y.C., Y-B.S., and W-J.L.; writing-original draft preparation, Y.C., S-L.L.; writing-review and editing, Y.C., S-L.L.; supervision, S-L.L.; project administration, S-L.L.; funding acquisition S-L.L.

This study was supported by a grant from the National Research Foundation of Korea (Grant number: NRF-2020R1G1A1007886) Republic of Korea.

All procedures were approved by the Institutional Animal Care and Use Committee of Gyeongsang National University (Permit No: GNU-210216-D0017).

Not applicable.

Not applicable.

Not applicable.

No potential conflict of interest relevant to this article was reported.